EMAIL THIS PAGE TO A FRIEND

PEG10

paternally expressed 10

291 Gene Product Result for
Synonyms: EDR HB-1 MEF3L Mar2 Mart2 RGAG3
UniProtKB ID: Q86TG7, Q96A68, Q9UPV1
Gene ID:
Human(23089) Summary: This is a paternally expressed imprinted gene that encodes transcripts containing two overlapping open reading frames (ORFs), RF1 and RF1/RF2, as well as retroviral-like slippage and pseudoknot elements, which can induce a -1 nucleotide frame-shift. ORF1 encodes a shorter isoform with a CCHC-type zinc finger motif containing a sequence characteristic of gag proteins of most retroviruses and some retrotransposons. The longer isoform is the result of -1 translational frame-shifting leading to translation of a gag/pol-like protein combining RF1 and RF2. It contains the active-site consensus sequence of the protease domain of pol proteins. Additional isoforms resulting from alternatively spliced transcript variants, as well as from use of upstream non-AUG (CUG) start codon, have been reported for this gene. Increased expression of this gene is associated with hepatocellular carcinomas. [provided by RefSeq, May 2010]
Mouse(170676) paternally expressed 10
Rat(678843) paternally expressed 10
domestic guinea pig(100720271) paternally expressed 10
naked mole-rat(101724514) paternally expressed 10
cow(618138) paternally expressed 10
sheep(100359412) paternally expressed 10
dog(482307) paternally expressed 10
Horse(100062501) paternally expressed 10
domestic cat(101094251) paternally expressed 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001040152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040152 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040152 Rosetta Predictions human pricing
NM_015068 Rosetta Predictions human pricing
XM_001053454 Rosetta Predictions rat pricing
NM_001040611 Rosetta Predictions mouse pricing
NM_130877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148845 predicted 1592
2 SASI_Hs01_00148846 predicted 1659
3 SASI_Hs01_00148847 predicted 797
4 SASI_Hs02_00308858 predicted 1655
5 SASI_Hs01_00148848 predicted 1596
6 SASI_Hs01_00148850 predicted 1659
7 SASI_Hs01_00148851 predicted 813
8 SASI_Hs01_00148852 predicted 1155
9 SASI_Hs01_00148853 predicted 1635
10 SASI_Hs01_00148854 predicted 803
11 SASI_Hs01_00148849 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191894 predicted 1595
2 SASI_Hs01_00191895 predicted 6274
3 SASI_Hs02_00346925 predicted 4318
4 SASI_Hs01_00191896 predicted 4476
5 SASI_Hs02_00346926 predicted 5039
6 SASI_Hs01_00191898 predicted 6186
7 SASI_Hs01_00191900 predicted 5685
8 SASI_Hs01_00191902 predicted 2293
9 SASI_Hs01_00191903 predicted 3326
10 SASI_Hs02_00346927 predicted 2182
11 SASI_Hs01_00191897 predicted 4229
12 SASI_Hs01_00191899 predicted 6158
13 SASI_Hs01_00191901 predicted 3427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272380 predicted 505
2 SASI_Rn02_00272381 predicted 524
3 SASI_Rn02_00272382 predicted 736
4 SASI_Rn02_00272383 predicted 673
5 SASI_Rn02_00272384 predicted 833
6 SASI_Rn02_00272385 predicted 756
7 SASI_Rn02_00272386 predicted 729
8 SASI_Rn02_00272387 predicted 479
9 SASI_Rn02_00272388 predicted 374
10 SASI_Rn02_00272389 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052048 predicted 1718
2 SASI_Mm01_00052049 predicted 863
3 SASI_Mm02_00290329 predicted 1720
4 SASI_Mm01_00052050 predicted 949
5 SASI_Mm01_00052051 predicted 1729
6 SASI_Mm01_00052053 predicted 1772
7 SASI_Mm01_00052054 predicted 1675
8 SASI_Mm02_00290330 predicted 1677
9 SASI_Mm01_00052055 predicted 1640
10 SASI_Mm02_00290331 predicted 950
11 SASI_Mm01_00052047 predicted 801
12 SASI_Mm01_00052052 predicted 967
13 SASI_Mm01_00052056 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200880 predicted 4149
2 SASI_Mm01_00200882 predicted 1716
3 SASI_Mm01_00200883 predicted 869
4 SASI_Mm01_00200884 predicted 948
5 SASI_Mm01_00200885 predicted 4298
6 SASI_Mm01_00200886 predicted 1732
7 SASI_Mm01_00200889 predicted 5452
8 SASI_Mm02_00338301 predicted 1771
9 SASI_Mm02_00338302 predicted 3918
10 SASI_Mm02_00338303 predicted 4109
11 SASI_Mm01_00200881 predicted 4422
12 SASI_Mm01_00200887 predicted 972
13 SASI_Mm01_00200888 predicted 4297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040611
PEG10 MISSION shRNA Bacterial Glycerol Stock
paternally expressed 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040611.1-3691s21c1
Sequence:CCGGATATGCTGGGCACCTTATAAACTCGAGTTTATAAGGTGCCCAGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-602s21c1
Sequence:CCGGTACAGTCTGCTGGATCATTTACTCGAGTAAATGATCCAGCAGACTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-544s21c1
Sequence:CCGGGAACAGGCAGTTTGAGAATATCTCGAGATATTCTCAAACTGCCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-968s21c1
Sequence:CCGGCACAACTACACTGCCTTTATGCTCGAGCATAAAGGCAGTGTAGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-1415s21c1
Sequence:CCGGTGTGGCAATGGAGGCCATTTCCTCGAGGAAATGGCCTCCATTGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040611
PEG10 MISSION shRNA shRNA Plasmid DNA
paternally expressed 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040611.1-3691s21c1
Sequence:CCGGATATGCTGGGCACCTTATAAACTCGAGTTTATAAGGTGCCCAGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-602s21c1
Sequence:CCGGTACAGTCTGCTGGATCATTTACTCGAGTAAATGATCCAGCAGACTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-544s21c1
Sequence:CCGGGAACAGGCAGTTTGAGAATATCTCGAGATATTCTCAAACTGCCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-968s21c1
Sequence:CCGGCACAACTACACTGCCTTTATGCTCGAGCATAAAGGCAGTGTAGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-1415s21c1
Sequence:CCGGTGTGGCAATGGAGGCCATTTCCTCGAGGAAATGGCCTCCATTGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040611
PEG10 MISSION shRNA Lentiviral Transduction Particles
paternally expressed 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040611.1-3691s21c1
Sequence:CCGGATATGCTGGGCACCTTATAAACTCGAGTTTATAAGGTGCCCAGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-602s21c1
Sequence:CCGGTACAGTCTGCTGGATCATTTACTCGAGTAAATGATCCAGCAGACTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-544s21c1
Sequence:CCGGGAACAGGCAGTTTGAGAATATCTCGAGATATTCTCAAACTGCCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-968s21c1
Sequence:CCGGCACAACTACACTGCCTTTATGCTCGAGCATAAAGGCAGTGTAGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040611.1-1415s21c1
Sequence:CCGGTGTGGCAATGGAGGCCATTTCCTCGAGGAAATGGCCTCCATTGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040152
VALIDATED
PEG10 MISSION shRNA Bacterial Glycerol Stock
paternally expressed 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1943s21c1
Sequence:CCGGCCACAACCGCCACTCTATTATCTCGAGATAATAGAGTGGCGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1153s21c1
Sequence:CCGGAGTCGCTGTCTGCTCTGATTGCTCGAGCAATCAGAGCAGACAGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1033s21c1
Sequence:CCGGCCAATGCTTTCCAGATGATTGCTCGAGCAATCATCTGGAAAGCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-934s21c1
Sequence:CCGGTGGAAATGAAGCATGTCTTTGCTCGAGCAAAGACATGCTTCATTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1381s21c1
Sequence:CCGGGAGGTCACTACGCTGACAATTCTCGAGAATTGTCAGCGTAGTGACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040152
VALIDATED
PEG10 MISSION shRNA shRNA Plasmid DNA
paternally expressed 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1943s21c1
Sequence:CCGGCCACAACCGCCACTCTATTATCTCGAGATAATAGAGTGGCGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1153s21c1
Sequence:CCGGAGTCGCTGTCTGCTCTGATTGCTCGAGCAATCAGAGCAGACAGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1033s21c1
Sequence:CCGGCCAATGCTTTCCAGATGATTGCTCGAGCAATCATCTGGAAAGCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-934s21c1
Sequence:CCGGTGGAAATGAAGCATGTCTTTGCTCGAGCAAAGACATGCTTCATTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1381s21c1
Sequence:CCGGGAGGTCACTACGCTGACAATTCTCGAGAATTGTCAGCGTAGTGACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040152
VALIDATED
PEG10 MISSION shRNA Lentiviral Transduction Particles
paternally expressed 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1943s21c1
Sequence:CCGGCCACAACCGCCACTCTATTATCTCGAGATAATAGAGTGGCGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1153s21c1
Sequence:CCGGAGTCGCTGTCTGCTCTGATTGCTCGAGCAATCAGAGCAGACAGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1033s21c1
Sequence:CCGGCCAATGCTTTCCAGATGATTGCTCGAGCAATCATCTGGAAAGCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-934s21c1
Sequence:CCGGTGGAAATGAAGCATGTCTTTGCTCGAGCAAAGACATGCTTCATTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040152.1-1381s21c1
Sequence:CCGGGAGGTCACTACGCTGACAATTCTCGAGAATTGTCAGCGTAGTGACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)