EMAIL THIS PAGE TO A FRIEND

PEG3

paternally expressed 3

186 Gene Product Result for
Synonyms: PW1 ZKSCAN22 ZNF904 ZSCAN24
Gene ID:
Human(5178) Summary: In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]
Mouse(18616) paternally expressed 3
Rat(246361) paternally expressed 3
cow(444864) paternally expressed 3
sheep(101112254) paternally expressed 3
sheep(100505405) paternally expressed 3
naked mole-rat(101714488) paternally expressed 3
dog(476371) paternally expressed 3
domestic cat(100510800) paternally expressed 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006210 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006210 Rosetta Predictions human pricing
NM_008817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061402 predicted 3016
2 SASI_Hs02_00341116 predicted 3541
3 SASI_Hs01_00061404 predicted 1786
4 SASI_Hs02_00341117 predicted 4913
5 SASI_Hs01_00061406 predicted 697
6 SASI_Hs01_00061408 predicted 3199
7 SASI_Hs01_00061410 predicted 2506
8 SASI_Hs01_00061411 predicted 2303
9 SASI_Hs02_00341118 predicted 1931
10 SASI_Hs02_00341119 predicted 2694
11 SASI_Hs01_00061403 predicted 5195
12 SASI_Hs01_00061405 predicted 2936
13 SASI_Hs01_00061407 predicted 4866
14 SASI_Hs01_00061409 predicted 3817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057874 predicted 1081
2 SASI_Mm01_00057875 predicted 2678
3 SASI_Mm01_00057876 predicted 3079
4 SASI_Mm01_00057877 predicted 3981
5 SASI_Mm02_00314752 predicted 3001
6 SASI_Mm01_00057878 predicted 3938
7 SASI_Mm02_00314753 predicted 1984
8 SASI_Mm01_00057879 predicted 1415
9 SASI_Mm01_00057880 predicted 2335
10 SASI_Mm01_00057881 predicted 5054
11 SASI_Mm01_00057882 predicted 4035
12 SASI_Mm01_00057883 predicted 3501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006210
PEG3 MISSION shRNA Bacterial Glycerol Stock
paternally expressed 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006210.2-5475s21c1
Sequence:CCGGGACACTTGTGTAACGTATATACTCGAGTATATACGTTACACAAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006210.2-3576s21c1
Sequence:CCGGAGGAGTCTCAAGGCGAGAATACTCGAGTATTCTCGCCTTGAGACTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006210.2-1472s21c1
Sequence:CCGGGTGATCCAGCAGCGGGTTTATCTCGAGATAAACCCGCTGCTGGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-455s1c1
Sequence:CCGGCCGGATGTCATCATAGGAGAACTCGAGTTCTCCTATGATGACATCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006210.1-5834s1c1
Sequence:CCGGGCCAACACTTTGGAACCTAATCTCGAGATTAGGTTCCAAAGTGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-4730s1c1
Sequence:CCGGGCAGGTATTGAAGACCCAGAACTCGAGTTCTGGGTCTTCAATACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-2201s1c1
Sequence:CCGGGCCCTTAATGAGTTTCAGAAACTCGAGTTTCTGAAACTCATTAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-3138s1c1
Sequence:CCGGCCAGCTCAAATGTCCGTGAATCTCGAGATTCACGGACATTTGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006210
PEG3 MISSION shRNA shRNA Plasmid DNA
paternally expressed 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006210.2-5475s21c1
Sequence:CCGGGACACTTGTGTAACGTATATACTCGAGTATATACGTTACACAAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006210.2-3576s21c1
Sequence:CCGGAGGAGTCTCAAGGCGAGAATACTCGAGTATTCTCGCCTTGAGACTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006210.2-1472s21c1
Sequence:CCGGGTGATCCAGCAGCGGGTTTATCTCGAGATAAACCCGCTGCTGGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-455s1c1
Sequence:CCGGCCGGATGTCATCATAGGAGAACTCGAGTTCTCCTATGATGACATCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006210.1-5834s1c1
Sequence:CCGGGCCAACACTTTGGAACCTAATCTCGAGATTAGGTTCCAAAGTGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-4730s1c1
Sequence:CCGGGCAGGTATTGAAGACCCAGAACTCGAGTTCTGGGTCTTCAATACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-2201s1c1
Sequence:CCGGGCCCTTAATGAGTTTCAGAAACTCGAGTTTCTGAAACTCATTAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-3138s1c1
Sequence:CCGGCCAGCTCAAATGTCCGTGAATCTCGAGATTCACGGACATTTGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006210
PEG3 MISSION shRNA Lentiviral Transduction Particles
paternally expressed 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006210.2-5475s21c1
Sequence:CCGGGACACTTGTGTAACGTATATACTCGAGTATATACGTTACACAAGTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006210.2-3576s21c1
Sequence:CCGGAGGAGTCTCAAGGCGAGAATACTCGAGTATTCTCGCCTTGAGACTCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006210.2-1472s21c1
Sequence:CCGGGTGATCCAGCAGCGGGTTTATCTCGAGATAAACCCGCTGCTGGATCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-455s1c1
Sequence:CCGGCCGGATGTCATCATAGGAGAACTCGAGTTCTCCTATGATGACATCCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006210.1-5834s1c1
Sequence:CCGGGCCAACACTTTGGAACCTAATCTCGAGATTAGGTTCCAAAGTGTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-4730s1c1
Sequence:CCGGGCAGGTATTGAAGACCCAGAACTCGAGTTCTGGGTCTTCAATACCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-2201s1c1
Sequence:CCGGGCCCTTAATGAGTTTCAGAAACTCGAGTTTCTGAAACTCATTAAGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006210.1-3138s1c1
Sequence:CCGGCCAGCTCAAATGTCCGTGAATCTCGAGATTCACGGACATTTGAGCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008817
VALIDATED
PEG3 MISSION shRNA Bacterial Glycerol Stock
paternally expressed 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008817.2-4305s21c1
Sequence:CCGGCCACTGTACGAATGCAAAGATCTCGAGATCTTTGCATTCGTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008817.2-5697s21c1
Sequence:CCGGCCTCTTAGATAGTCCTGTGAACTCGAGTTCACAGGACTATCTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008817.2-2285s21c1
Sequence:CCGGCCCTAATGACAAGCTGAAATTCTCGAGAATTTCAGCTTGTCATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-660s1c1
Sequence:CCGGGCCGAGTCATACCAGAATGTTCTCGAGAACATTCTGGTATGACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-2285s1c1
Sequence:CCGGCCCTAATGACAAGCTGAAATTCTCGAGAATTTCAGCTTGTCATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-4305s1c1
Sequence:CCGGCCACTGTACGAATGCAAAGATCTCGAGATCTTTGCATTCGTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008817.2-2602s1c1
Sequence:CCGGCCTCCATTTATATCCCAGATACTCGAGTATCTGGGATATAAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-5697s1c1
Sequence:CCGGCCTCTTAGATAGTCCTGTGAACTCGAGTTCACAGGACTATCTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008817.2-660s21c1
Sequence:CCGGGCCGAGTCATACCAGAATGTTCTCGAGAACATTCTGGTATGACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008817
VALIDATED
PEG3 MISSION shRNA shRNA Plasmid DNA
paternally expressed 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008817.2-4305s21c1
Sequence:CCGGCCACTGTACGAATGCAAAGATCTCGAGATCTTTGCATTCGTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008817.2-5697s21c1
Sequence:CCGGCCTCTTAGATAGTCCTGTGAACTCGAGTTCACAGGACTATCTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008817.2-2285s21c1
Sequence:CCGGCCCTAATGACAAGCTGAAATTCTCGAGAATTTCAGCTTGTCATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-660s1c1
Sequence:CCGGGCCGAGTCATACCAGAATGTTCTCGAGAACATTCTGGTATGACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-2285s1c1
Sequence:CCGGCCCTAATGACAAGCTGAAATTCTCGAGAATTTCAGCTTGTCATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-4305s1c1
Sequence:CCGGCCACTGTACGAATGCAAAGATCTCGAGATCTTTGCATTCGTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008817.2-2602s1c1
Sequence:CCGGCCTCCATTTATATCCCAGATACTCGAGTATCTGGGATATAAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-5697s1c1
Sequence:CCGGCCTCTTAGATAGTCCTGTGAACTCGAGTTCACAGGACTATCTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008817.2-660s21c1
Sequence:CCGGGCCGAGTCATACCAGAATGTTCTCGAGAACATTCTGGTATGACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008817
VALIDATED
PEG3 MISSION shRNA Lentiviral Transduction Particles
paternally expressed 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008817.2-4305s21c1
Sequence:CCGGCCACTGTACGAATGCAAAGATCTCGAGATCTTTGCATTCGTACAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008817.2-5697s21c1
Sequence:CCGGCCTCTTAGATAGTCCTGTGAACTCGAGTTCACAGGACTATCTAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008817.2-2285s21c1
Sequence:CCGGCCCTAATGACAAGCTGAAATTCTCGAGAATTTCAGCTTGTCATTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-660s1c1
Sequence:CCGGGCCGAGTCATACCAGAATGTTCTCGAGAACATTCTGGTATGACTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-2285s1c1
Sequence:CCGGCCCTAATGACAAGCTGAAATTCTCGAGAATTTCAGCTTGTCATTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-4305s1c1
Sequence:CCGGCCACTGTACGAATGCAAAGATCTCGAGATCTTTGCATTCGTACAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008817.2-2602s1c1
Sequence:CCGGCCTCCATTTATATCCCAGATACTCGAGTATCTGGGATATAAATGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008817.2-5697s1c1
Sequence:CCGGCCTCTTAGATAGTCCTGTGAACTCGAGTTCACAGGACTATCTAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008817.2-660s21c1
Sequence:CCGGGCCGAGTCATACCAGAATGTTCTCGAGAACATTCTGGTATGACTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)