EMAIL THIS PAGE TO A FRIEND

PELI2

pellino E3 ubiquitin protein ligase family member 2

173 Gene Product Result for
UniProtKB ID: Q9HAT8, B2RDY5
Gene ID:
Mouse(93834) pellino 2
Rat(305835) pellino E3 ubiquitin protein ligase family member 2
Zebrafish(436889) pellino homolog 2 (Drosophila)
chicken(776013) pellino homolog 2 (Drosophila)
dog(611036) pellino E3 ubiquitin protein ligase family member 2
domestic cat(101093865) pellino E3 ubiquitin protein ligase family member 2
Horse(100057689) pellino E3 ubiquitin protein ligase family member 2
domestic guinea pig(100731206) pellino E3 ubiquitin protein ligase family member 2
Domestic Rabbit(100350938) pellino E3 ubiquitin protein ligase family member 2
naked mole-rat(101726164) pellino E3 ubiquitin protein ligase family member 2
cow(100337503) pellino E3 ubiquitin protein ligase family member 2
sheep(101114278) pellino E3 ubiquitin protein ligase family member 2
cow(540618) pellino homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021255 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021255 Rosetta Predictions human pricing
NM_001107259 Rosetta Predictions rat pricing
NM_033602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038955 predicted 740
2 SASI_Hs01_00038956 predicted 564
3 SASI_Hs01_00038957 predicted 743
4 SASI_Hs01_00038958 predicted 599
5 SASI_Hs01_00038959 predicted 640
6 SASI_Hs01_00038960 predicted 969
7 SASI_Hs02_00354915 predicted 1429
8 SASI_Hs01_00038963 predicted 579
9 SASI_Hs01_00038964 predicted 496
10 SASI_Hs02_00354916 predicted 671
11 SASI_Hs01_00038961 predicted 563
12 SASI_Hs01_00038962 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227075 predicted 692
2 SASI_Rn02_00227076 predicted 1043
3 SASI_Rn02_00227077 predicted 969
4 SASI_Rn02_00227078 predicted 459
5 SASI_Rn02_00227079 predicted 518
6 SASI_Rn02_00227080 predicted 579
7 SASI_Rn02_00227081 predicted 534
8 SASI_Rn02_00227082 predicted 473
9 SASI_Rn02_00227083 predicted 798
10 SASI_Rn02_00227084 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159627 predicted 544
2 SASI_Mm02_00337461 predicted 1554
3 SASI_Mm02_00337462 predicted 1583
4 SASI_Mm01_00159628 predicted 503
5 SASI_Mm01_00159629 predicted 721
6 SASI_Mm02_00337463 predicted 1414
7 SASI_Mm01_00159630 predicted 738
8 SASI_Mm01_00159632 predicted 568
9 SASI_Mm01_00159633 predicted 590
10 SASI_Mm01_00159634 predicted 1001
11 SASI_Mm01_00159631 predicted 687
12 SASI_Mm01_00159635 predicted 682
13 SASI_Mm01_00159636 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033602
PELI2 MISSION shRNA Bacterial Glycerol Stock
pellino E3 ubiquitin protein ligase family member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033602.1-1004s1c1
Sequence:CCGGGCTCCTACTCAGAAGCACATACTCGAGTATGTGCTTCTGAGTAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033602.1-379s1c1
Sequence:CCGGCAAACCCAGCACAATCCACATCTCGAGATGTGGATTGTGCTGGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-409s21c1
Sequence:CCGGAGCAGATTTGCCCTCTATAAGCTCGAGCTTATAGAGGGCAAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216895    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033602.2-4740s1c1
Sequence:CCGGGAATGCCAGGACTAGCATAAACTCGAGTTTATGCTAGTCCTGGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-323s21c1
Sequence:CCGGCCAACAAGGAGCCGGTGAAATCTCGAGATTTCACCGGCTCCTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-732s21c1
Sequence:CCGGGCCATACACAGCACGCATATTCTCGAGAATATGCGTGCTGTGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033602.2-3104s21c1
Sequence:CCGGGCCCATTAGCAGATACTATTTCTCGAGAAATAGTATCTGCTAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-559s21c1
Sequence:CCGGGTGGAGTACACACACGATAAACTCGAGTTTATCGTGTGTGTACTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033602
PELI2 MISSION shRNA shRNA Plasmid DNA
pellino E3 ubiquitin protein ligase family member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033602.1-1004s1c1
Sequence:CCGGGCTCCTACTCAGAAGCACATACTCGAGTATGTGCTTCTGAGTAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033602.1-379s1c1
Sequence:CCGGCAAACCCAGCACAATCCACATCTCGAGATGTGGATTGTGCTGGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-409s21c1
Sequence:CCGGAGCAGATTTGCCCTCTATAAGCTCGAGCTTATAGAGGGCAAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216895    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033602.2-4740s1c1
Sequence:CCGGGAATGCCAGGACTAGCATAAACTCGAGTTTATGCTAGTCCTGGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-323s21c1
Sequence:CCGGCCAACAAGGAGCCGGTGAAATCTCGAGATTTCACCGGCTCCTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-732s21c1
Sequence:CCGGGCCATACACAGCACGCATATTCTCGAGAATATGCGTGCTGTGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033602.2-3104s21c1
Sequence:CCGGGCCCATTAGCAGATACTATTTCTCGAGAAATAGTATCTGCTAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-559s21c1
Sequence:CCGGGTGGAGTACACACACGATAAACTCGAGTTTATCGTGTGTGTACTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033602
PELI2 MISSION shRNA Lentiviral Transduction Particles
pellino E3 ubiquitin protein ligase family member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033602.1-1004s1c1
Sequence:CCGGGCTCCTACTCAGAAGCACATACTCGAGTATGTGCTTCTGAGTAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033602.1-379s1c1
Sequence:CCGGCAAACCCAGCACAATCCACATCTCGAGATGTGGATTGTGCTGGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-409s21c1
Sequence:CCGGAGCAGATTTGCCCTCTATAAGCTCGAGCTTATAGAGGGCAAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216895    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033602.2-4740s1c1
Sequence:CCGGGAATGCCAGGACTAGCATAAACTCGAGTTTATGCTAGTCCTGGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-323s21c1
Sequence:CCGGCCAACAAGGAGCCGGTGAAATCTCGAGATTTCACCGGCTCCTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-732s21c1
Sequence:CCGGGCCATACACAGCACGCATATTCTCGAGAATATGCGTGCTGTGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033602.2-3104s21c1
Sequence:CCGGGCCCATTAGCAGATACTATTTCTCGAGAAATAGTATCTGCTAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033602.2-559s21c1
Sequence:CCGGGTGGAGTACACACACGATAAACTCGAGTTTATCGTGTGTGTACTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021255
VALIDATED
PELI2 MISSION shRNA Bacterial Glycerol Stock
pellino E3 ubiquitin protein ligase family member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021255.1-249s1c1
Sequence:CCGGCTCGGGTACAATGGTGCTTTACTCGAGTAAAGCACCATTGTACCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021255.1-1334s1c1
Sequence:CCGGGCCTCATGGAACTCATGCATTCTCGAGAATGCATGAGTTCCATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-2192s1c1
Sequence:CCGGCCAGAACTGTTTGGTTGATTACTCGAGTAATCAACCAAACAGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-4929s1c1
Sequence:CCGGCCATTGTTAATGCTGGGTAAACTCGAGTTTACCCAGCATTAACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021255.1-394s1c1
Sequence:CCGGGCAAAGGTCAACACAGTATATCTCGAGATATACTGTGTTGACCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-3500s1c1
Sequence:CCGGCCAGAGAGTTAGGTATATCATCTCGAGATGATATACCTAACTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021255.1-491s1c1
Sequence:CCGGCAGATCAACAGAAAGCCCTATCTCGAGATAGGGCTTTCTGTTGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-621s1c1
Sequence:CCGGGAACCTTACACAGCACGGATACTCGAGTATCCGTGCTGTGTAAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021255.1-648s1c1
Sequence:CCGGGCCGGATTTGACTCTTCCAAACTCGAGTTTGGAAGAGTCAAATCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021255
VALIDATED
PELI2 MISSION shRNA shRNA Plasmid DNA
pellino E3 ubiquitin protein ligase family member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021255.1-249s1c1
Sequence:CCGGCTCGGGTACAATGGTGCTTTACTCGAGTAAAGCACCATTGTACCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021255.1-1334s1c1
Sequence:CCGGGCCTCATGGAACTCATGCATTCTCGAGAATGCATGAGTTCCATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-2192s1c1
Sequence:CCGGCCAGAACTGTTTGGTTGATTACTCGAGTAATCAACCAAACAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-4929s1c1
Sequence:CCGGCCATTGTTAATGCTGGGTAAACTCGAGTTTACCCAGCATTAACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021255.1-394s1c1
Sequence:CCGGGCAAAGGTCAACACAGTATATCTCGAGATATACTGTGTTGACCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-3500s1c1
Sequence:CCGGCCAGAGAGTTAGGTATATCATCTCGAGATGATATACCTAACTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021255.1-491s1c1
Sequence:CCGGCAGATCAACAGAAAGCCCTATCTCGAGATAGGGCTTTCTGTTGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-621s1c1
Sequence:CCGGGAACCTTACACAGCACGGATACTCGAGTATCCGTGCTGTGTAAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021255.1-648s1c1
Sequence:CCGGGCCGGATTTGACTCTTCCAAACTCGAGTTTGGAAGAGTCAAATCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021255
VALIDATED
PELI2 MISSION shRNA Lentiviral Transduction Particles
pellino E3 ubiquitin protein ligase family member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021255.1-249s1c1
Sequence:CCGGCTCGGGTACAATGGTGCTTTACTCGAGTAAAGCACCATTGTACCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021255.1-1334s1c1
Sequence:CCGGGCCTCATGGAACTCATGCATTCTCGAGAATGCATGAGTTCCATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-2192s1c1
Sequence:CCGGCCAGAACTGTTTGGTTGATTACTCGAGTAATCAACCAAACAGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-4929s1c1
Sequence:CCGGCCATTGTTAATGCTGGGTAAACTCGAGTTTACCCAGCATTAACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021255.1-394s1c1
Sequence:CCGGGCAAAGGTCAACACAGTATATCTCGAGATATACTGTGTTGACCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-3500s1c1
Sequence:CCGGCCAGAGAGTTAGGTATATCATCTCGAGATGATATACCTAACTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021255.1-491s1c1
Sequence:CCGGCAGATCAACAGAAAGCCCTATCTCGAGATAGGGCTTTCTGTTGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021255.1-621s1c1
Sequence:CCGGGAACCTTACACAGCACGGATACTCGAGTATCCGTGCTGTGTAAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021255.1-648s1c1
Sequence:CCGGGCCGGATTTGACTCTTCCAAACTCGAGTTTGGAAGAGTCAAATCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)