EMAIL THIS PAGE TO A FRIEND

PELI3

pellino E3 ubiquitin protein ligase family member 3

82 Gene Product Result for
UniProtKB ID: Q8N2H9, Q8N3E1, Q8N9Q6, Q8TAW7, Q8TED5
Gene ID:
Human(246330) Summary: The protein encoded by this gene is a scaffold protein and an intermediate signaling protein in the innate immune response pathway. The encoded protein helps transmit the immune response signal from Toll-like receptors to IRAK1/TRAF6 complexes. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
Mouse(240518) pellino 3
Rat(309157) pellino E3 ubiquitin protein ligase family member 3
cow(504839) pellino homolog 3 (Drosophila)
sheep(101114654) pellino E3 ubiquitin protein ligase family member 3
naked mole-rat(101722089) pellino E3 ubiquitin protein ligase family member 3
Domestic Rabbit(100352313) pellino E3 ubiquitin protein ligase family member 3
domestic guinea pig(100716351) pellino E3 ubiquitin protein ligase family member 3
dog(483710) pellino E3 ubiquitin protein ligase family member 3
domestic cat(101085749) pellino E3 ubiquitin protein ligase family member 3
Horse(100052587) pellino E3 ubiquitin protein ligase family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145065 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098510 Rosetta Predictions human pricing
NM_145065 Rosetta Predictions human pricing
NM_001127542 Rosetta Predictions rat pricing
NM_172835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319167 predicted 683
2 SASI_Hs02_00319168 predicted 710
3 SASI_Hs02_00319169 predicted 1602
4 SASI_Hs02_00319170 predicted 559
5 SASI_Hs02_00319171 predicted 680
6 SASI_Hs02_00319172 predicted 793
7 SASI_Hs02_00319173 predicted 695
8 SASI_Hs02_00319174 predicted 574
9 SASI_Hs02_00319175 predicted 568
10 SASI_Hs02_00319176 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051738 predicted 749
2 SASI_Hs01_00051739 predicted 777
3 SASI_Hs01_00051740 predicted 1671
4 SASI_Hs01_00051741 predicted 632
5 SASI_Hs01_00051742 predicted 753
6 SASI_Hs01_00051743 predicted 862
7 SASI_Hs01_00051744 predicted 768
8 SASI_Hs01_00051745 predicted 640
9 SASI_Hs01_00051746 predicted 636
10 SASI_Hs01_00051747 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254173 predicted 665
2 SASI_Rn02_00254174 predicted 377
3 SASI_Rn02_00254175 predicted 659
4 SASI_Rn02_00254176 predicted 863
5 SASI_Rn02_00254177 predicted 843
6 SASI_Rn02_00254178 predicted 1643
7 SASI_Rn02_00254179 predicted 552
8 SASI_Rn02_00254180 predicted 1146
9 SASI_Rn02_00254181 predicted 1572
10 SASI_Rn02_00254182 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344765 predicted 507
2 SASI_Mm01_00149169 predicted 846
3 SASI_Mm01_00149168 predicted 1645
4 SASI_Mm01_00149170 predicted 1160
5 SASI_Mm01_00149171 predicted 636
6 SASI_Mm01_00149173 predicted 1150
7 SASI_Mm02_00344766 predicted 1680
8 SASI_Mm01_00149175 predicted 453
9 SASI_Mm02_00344767 predicted 839
10 SASI_Mm01_00149174 predicted 1647
11 SASI_Mm01_00149167 predicted 1646
12 SASI_Mm01_00149172 predicted 523
13 SASI_Mm01_00149176 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145065
PELI3 MISSION shRNA Bacterial Glycerol Stock
pellino E3 ubiquitin protein ligase family member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145065.2-571s21c1
Sequence:CCGGACTCGGTCATAGTGGAGTATACTCGAGTATACTCCACTATGACCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-224s1c1
Sequence:CCGGCCATCAAGTATGGTGAACTCACTCGAGTGAGTTCACCATACTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-319s1c1
Sequence:CCGGCTCAGCTGCTACAATGGTTGTCTCGAGACAACCATTGTAGCAGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145065.1-726s1c1
Sequence:CCGGCGATGCCTCTAGCAACATCTTCTCGAGAAGATGTTGCTAGAGGCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139033    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145065.1-1886s1c1
Sequence:CCGGCCAGTTTCAGACACTCATCCTCTCGAGAGGATGAGTGTCTGAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-540s1c1
Sequence:CCGGCGACACAGACATGTTCCAGATCTCGAGATCTGGAACATGTCTGTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145065.1-2043s1c1
Sequence:CCGGGCACTTGCTGATAGCCACTATCTCGAGATAGTGGCTATCAGCAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-220s1c1
Sequence:CCGGGAGCCCATCAAGTATGGTGAACTCGAGTTCACCATACTTGATGGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145065
PELI3 MISSION shRNA shRNA Plasmid DNA
pellino E3 ubiquitin protein ligase family member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145065.2-571s21c1
Sequence:CCGGACTCGGTCATAGTGGAGTATACTCGAGTATACTCCACTATGACCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-224s1c1
Sequence:CCGGCCATCAAGTATGGTGAACTCACTCGAGTGAGTTCACCATACTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-319s1c1
Sequence:CCGGCTCAGCTGCTACAATGGTTGTCTCGAGACAACCATTGTAGCAGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145065.1-726s1c1
Sequence:CCGGCGATGCCTCTAGCAACATCTTCTCGAGAAGATGTTGCTAGAGGCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139033    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145065.1-1886s1c1
Sequence:CCGGCCAGTTTCAGACACTCATCCTCTCGAGAGGATGAGTGTCTGAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-540s1c1
Sequence:CCGGCGACACAGACATGTTCCAGATCTCGAGATCTGGAACATGTCTGTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145065.1-2043s1c1
Sequence:CCGGGCACTTGCTGATAGCCACTATCTCGAGATAGTGGCTATCAGCAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-220s1c1
Sequence:CCGGGAGCCCATCAAGTATGGTGAACTCGAGTTCACCATACTTGATGGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145065
PELI3 MISSION shRNA Lentiviral Transduction Particles
pellino E3 ubiquitin protein ligase family member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145065.2-571s21c1
Sequence:CCGGACTCGGTCATAGTGGAGTATACTCGAGTATACTCCACTATGACCGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-224s1c1
Sequence:CCGGCCATCAAGTATGGTGAACTCACTCGAGTGAGTTCACCATACTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-319s1c1
Sequence:CCGGCTCAGCTGCTACAATGGTTGTCTCGAGACAACCATTGTAGCAGCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145065.1-726s1c1
Sequence:CCGGCGATGCCTCTAGCAACATCTTCTCGAGAAGATGTTGCTAGAGGCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139033    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145065.1-1886s1c1
Sequence:CCGGCCAGTTTCAGACACTCATCCTCTCGAGAGGATGAGTGTCTGAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-540s1c1
Sequence:CCGGCGACACAGACATGTTCCAGATCTCGAGATCTGGAACATGTCTGTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140561    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145065.1-2043s1c1
Sequence:CCGGGCACTTGCTGATAGCCACTATCTCGAGATAGTGGCTATCAGCAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145065.1-220s1c1
Sequence:CCGGGAGCCCATCAAGTATGGTGAACTCGAGTTCACCATACTTGATGGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172835
PELI3 MISSION shRNA Bacterial Glycerol Stock
pellino E3 ubiquitin protein ligase family member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-583s1c1
Sequence:CCGGCAAAGTACCATCTCCCGCTATCTCGAGATAGCGGGAGATGGTACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-481s1c1
Sequence:CCGGGACAAAGACATGTTCCAGATTCTCGAGAATCTGGAACATGTCTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172835.2-1645s1c1
Sequence:CCGGCAGGCATACTGATAGGGACTTCTCGAGAAGTCCCTATCAGTATGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-465s1c1
Sequence:CCGGGTACACACATGACAGCGACAACTCGAGTTGTCGCTGTCATGTGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-356s1c1
Sequence:CCGGCAGATGTCATGCACCACATCTCTCGAGAGATGTGGTGCATGACATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172835
PELI3 MISSION shRNA shRNA Plasmid DNA
pellino E3 ubiquitin protein ligase family member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-583s1c1
Sequence:CCGGCAAAGTACCATCTCCCGCTATCTCGAGATAGCGGGAGATGGTACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-481s1c1
Sequence:CCGGGACAAAGACATGTTCCAGATTCTCGAGAATCTGGAACATGTCTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172835.2-1645s1c1
Sequence:CCGGCAGGCATACTGATAGGGACTTCTCGAGAAGTCCCTATCAGTATGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-465s1c1
Sequence:CCGGGTACACACATGACAGCGACAACTCGAGTTGTCGCTGTCATGTGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-356s1c1
Sequence:CCGGCAGATGTCATGCACCACATCTCTCGAGAGATGTGGTGCATGACATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172835
PELI3 MISSION shRNA Lentiviral Transduction Particles
pellino E3 ubiquitin protein ligase family member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-583s1c1
Sequence:CCGGCAAAGTACCATCTCCCGCTATCTCGAGATAGCGGGAGATGGTACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-481s1c1
Sequence:CCGGGACAAAGACATGTTCCAGATTCTCGAGAATCTGGAACATGTCTTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172835.2-1645s1c1
Sequence:CCGGCAGGCATACTGATAGGGACTTCTCGAGAAGTCCCTATCAGTATGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-465s1c1
Sequence:CCGGGTACACACATGACAGCGACAACTCGAGTTGTCGCTGTCATGTGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172835.2-356s1c1
Sequence:CCGGCAGATGTCATGCACCACATCTCTCGAGAGATGTGGTGCATGACATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)