EMAIL THIS PAGE TO A FRIEND

PELO

pelota homolog (Drosophila)

224 Gene Product Result for
Synonyms: PRO1770
UniProtKB ID: Q9BRX2, Q9GZS6, Q9Y306
Gene ID:
Human(53918) Summary: This gene encodes a protein which contains a conserved nuclear localization signal. The encoded protein may have a role in spermatogenesis, cell cycle control, and in meiotic cell division. [provided by RefSeq, Jul 2008]
Mouse(105083) pelota homolog (Drosophila)
Rat(294754) pelota homolog (Drosophila)
Zebrafish(394111) pelota homolog (Drosophila)
domestic cat(101089983) pelota homolog (Drosophila)
dog(479338) pelota homolog (Drosophila)
chicken(430689) pelota homolog (Drosophila)
domestic guinea pig(100728426) pelota homolog (Drosophila)
naked mole-rat(101702882) pelota homolog (Drosophila)
cow(528728) pelota homolog (Drosophila)
sheep(101120109) pelota homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015946 Rosetta Predictions human pricing
NM_001007634 Rosetta Predictions rat pricing
NM_134058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044069 predicted 1808
2 SASI_Hs01_00044070 predicted 1838
3 SASI_Hs01_00044071 predicted 2132
4 SASI_Hs01_00044072 predicted 1553
5 SASI_Hs01_00044074 predicted 1606
6 SASI_Hs01_00044076 predicted 1907
7 SASI_Hs01_00044077 predicted 2175
8 SASI_Hs01_00044078 predicted 1062
9 SASI_Hs02_00348586 predicted 2117
10 SASI_Hs02_00348587 predicted 1803
11 SASI_Hs01_00044073 predicted 1905
12 SASI_Hs01_00044075 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104025 predicted 739
2 SASI_Rn01_00104027 predicted 1070
3 SASI_Rn01_00104028 predicted 864
4 SASI_Rn02_00198739 predicted 775
5 SASI_Rn02_00198740 predicted 822
6 SASI_Rn01_00104029 predicted 1054
7 SASI_Rn01_00104030 predicted 1095
8 SASI_Rn01_00104031 predicted 400
9 SASI_Rn01_00104032 predicted 795
10 SASI_Rn02_00198741 predicted 479
11 SASI_Rn01_00104026 predicted 981
12 SASI_Rn01_00104033 predicted 702
13 SASI_Rn01_00104034 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339222 predicted 590
2 SASI_Mm01_00033156 predicted 1147
3 SASI_Mm01_00033158 predicted 1135
4 SASI_Mm01_00033159 predicted 1241
5 SASI_Mm01_00033160 predicted 940
6 SASI_Mm01_00033162 predicted 1176
7 SASI_Mm01_00033163 predicted 905
8 SASI_Mm01_00033164 predicted 820
9 SASI_Mm01_00033165 predicted 892
10 SASI_Mm02_00339223 predicted 1137
11 SASI_Mm01_00033157 predicted 369
12 SASI_Mm01_00033161 predicted 932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134058
VALIDATED
PELO MISSION shRNA Bacterial Glycerol Stock
pelota homolog (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1400s21c1
Sequence:CCGGCTGGCAGTTAATAGTTTCTTCCTCGAGGAAGAAACTATTAACTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-499s21c1
Sequence:CCGGATATCCAAGAGAATGAGTATGCTCGAGCATACTCATTCTCTTGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134058.1-973s1c1
Sequence:CCGGGCTGTGAAGACGGACAATAAACTCGAGTTTATTGTCCGTCTTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1408s21c1
Sequence:CCGGTAATAGTTTCTTCCCTGGTTTCTCGAGAAACCAGGGAAGAAACTATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134058.1-1464s1c1
Sequence:CCGGGCAGTTAATAGTTTCGTCCCTCTCGAGAGGGACGAAACTATTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134058.1-970s1c1
Sequence:CCGGCAAGCTGTGAAGACGGACAATCTCGAGATTGTCCGTCTTCACAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134058.1-883s1c1
Sequence:CCGGCGCCACATAAACTTCGAGGTTCTCGAGAACCTCGAAGTTTATGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134058.3-909s21c1
Sequence:CCGGCAAGCTGTGAAGACGGACAATCTCGAGATTGTCCGTCTTCACAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1255s21c1
Sequence:CCGGATGCGGGCACCGTAAGGATATCTCGAGATATCCTTACGGTGCCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1390s21c1
Sequence:CCGGAGGATTAAGACTGGCAGTTAACTCGAGTTAACTGCCAGTCTTAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134058
VALIDATED
PELO MISSION shRNA shRNA Plasmid DNA
pelota homolog (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1400s21c1
Sequence:CCGGCTGGCAGTTAATAGTTTCTTCCTCGAGGAAGAAACTATTAACTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-499s21c1
Sequence:CCGGATATCCAAGAGAATGAGTATGCTCGAGCATACTCATTCTCTTGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134058.1-973s1c1
Sequence:CCGGGCTGTGAAGACGGACAATAAACTCGAGTTTATTGTCCGTCTTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1408s21c1
Sequence:CCGGTAATAGTTTCTTCCCTGGTTTCTCGAGAAACCAGGGAAGAAACTATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134058.1-1464s1c1
Sequence:CCGGGCAGTTAATAGTTTCGTCCCTCTCGAGAGGGACGAAACTATTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134058.1-970s1c1
Sequence:CCGGCAAGCTGTGAAGACGGACAATCTCGAGATTGTCCGTCTTCACAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134058.1-883s1c1
Sequence:CCGGCGCCACATAAACTTCGAGGTTCTCGAGAACCTCGAAGTTTATGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134058.3-909s21c1
Sequence:CCGGCAAGCTGTGAAGACGGACAATCTCGAGATTGTCCGTCTTCACAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1255s21c1
Sequence:CCGGATGCGGGCACCGTAAGGATATCTCGAGATATCCTTACGGTGCCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1390s21c1
Sequence:CCGGAGGATTAAGACTGGCAGTTAACTCGAGTTAACTGCCAGTCTTAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134058
VALIDATED
PELO MISSION shRNA Lentiviral Transduction Particles
pelota homolog (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1400s21c1
Sequence:CCGGCTGGCAGTTAATAGTTTCTTCCTCGAGGAAGAAACTATTAACTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-499s21c1
Sequence:CCGGATATCCAAGAGAATGAGTATGCTCGAGCATACTCATTCTCTTGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134058.1-973s1c1
Sequence:CCGGGCTGTGAAGACGGACAATAAACTCGAGTTTATTGTCCGTCTTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1408s21c1
Sequence:CCGGTAATAGTTTCTTCCCTGGTTTCTCGAGAAACCAGGGAAGAAACTATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134058.1-1464s1c1
Sequence:CCGGGCAGTTAATAGTTTCGTCCCTCTCGAGAGGGACGAAACTATTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134058.1-970s1c1
Sequence:CCGGCAAGCTGTGAAGACGGACAATCTCGAGATTGTCCGTCTTCACAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134058.1-883s1c1
Sequence:CCGGCGCCACATAAACTTCGAGGTTCTCGAGAACCTCGAAGTTTATGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134058.3-909s21c1
Sequence:CCGGCAAGCTGTGAAGACGGACAATCTCGAGATTGTCCGTCTTCACAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1255s21c1
Sequence:CCGGATGCGGGCACCGTAAGGATATCTCGAGATATCCTTACGGTGCCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134058.3-1390s21c1
Sequence:CCGGAGGATTAAGACTGGCAGTTAACTCGAGTTAACTGCCAGTCTTAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015946
VALIDATED
PELO MISSION shRNA Bacterial Glycerol Stock
pelota homolog (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2342s21c1
Sequence:CCGGCGTACTACCATCTTGATTAAACTCGAGTTTAATCAAGATGGTAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2448s21c1
Sequence:CCGGTATATTGTTTGGGATAGATTGCTCGAGCAATCTATCCCAAACAATATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2385s21c1
Sequence:CCGGTATGAGTTATCTGTAGTACTTCTCGAGAAGTACTACAGATAACTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2566s21c1
Sequence:CCGGGTGTTCTTGCATTGCATTTAACTCGAGTTAAATGCAATGCAAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015946.4-2520s1c1
Sequence:CCGGGCTATCTTATCCTGTTTACATCTCGAGATGTAAACAGGATAAGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015946.4-1571s1c1
Sequence:CCGGCACATACACTTTGATGTTGTACTCGAGTACAACATCAAAGTGTATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015946.4-1658s1c1
Sequence:CCGGGCAGTGAAGACCGACAACAAACTCGAGTTTGTTGTCGGTCTTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015946.4-2662s1c1
Sequence:CCGGCGTACAATTAGTAGACTTGAACTCGAGTTCAAGTCTACTAATTGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2433s21c1
Sequence:CCGGACGATGCCTATGCAGTATATTCTCGAGAATATACTGCATAGGCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015946.4-1568s1c1
Sequence:CCGGCGCCACATACACTTTGATGTTCTCGAGAACATCAAAGTGTATGTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015946
VALIDATED
PELO MISSION shRNA shRNA Plasmid DNA
pelota homolog (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2342s21c1
Sequence:CCGGCGTACTACCATCTTGATTAAACTCGAGTTTAATCAAGATGGTAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2448s21c1
Sequence:CCGGTATATTGTTTGGGATAGATTGCTCGAGCAATCTATCCCAAACAATATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2385s21c1
Sequence:CCGGTATGAGTTATCTGTAGTACTTCTCGAGAAGTACTACAGATAACTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2566s21c1
Sequence:CCGGGTGTTCTTGCATTGCATTTAACTCGAGTTAAATGCAATGCAAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015946.4-2520s1c1
Sequence:CCGGGCTATCTTATCCTGTTTACATCTCGAGATGTAAACAGGATAAGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015946.4-1571s1c1
Sequence:CCGGCACATACACTTTGATGTTGTACTCGAGTACAACATCAAAGTGTATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015946.4-1658s1c1
Sequence:CCGGGCAGTGAAGACCGACAACAAACTCGAGTTTGTTGTCGGTCTTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015946.4-2662s1c1
Sequence:CCGGCGTACAATTAGTAGACTTGAACTCGAGTTCAAGTCTACTAATTGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2433s21c1
Sequence:CCGGACGATGCCTATGCAGTATATTCTCGAGAATATACTGCATAGGCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015946.4-1568s1c1
Sequence:CCGGCGCCACATACACTTTGATGTTCTCGAGAACATCAAAGTGTATGTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015946
VALIDATED
PELO MISSION shRNA Lentiviral Transduction Particles
pelota homolog (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2342s21c1
Sequence:CCGGCGTACTACCATCTTGATTAAACTCGAGTTTAATCAAGATGGTAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2448s21c1
Sequence:CCGGTATATTGTTTGGGATAGATTGCTCGAGCAATCTATCCCAAACAATATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2385s21c1
Sequence:CCGGTATGAGTTATCTGTAGTACTTCTCGAGAAGTACTACAGATAACTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2566s21c1
Sequence:CCGGGTGTTCTTGCATTGCATTTAACTCGAGTTAAATGCAATGCAAGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015946.4-2520s1c1
Sequence:CCGGGCTATCTTATCCTGTTTACATCTCGAGATGTAAACAGGATAAGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015946.4-1571s1c1
Sequence:CCGGCACATACACTTTGATGTTGTACTCGAGTACAACATCAAAGTGTATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015946.4-1658s1c1
Sequence:CCGGGCAGTGAAGACCGACAACAAACTCGAGTTTGTTGTCGGTCTTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015946.4-2662s1c1
Sequence:CCGGCGTACAATTAGTAGACTTGAACTCGAGTTCAAGTCTACTAATTGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015946.4-2433s21c1
Sequence:CCGGACGATGCCTATGCAGTATATTCTCGAGAATATACTGCATAGGCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015946.4-1568s1c1
Sequence:CCGGCGCCACATACACTTTGATGTTCTCGAGAACATCAAAGTGTATGTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)