EMAIL THIS PAGE TO A FRIEND

PEMT

phosphatidylethanolamine N-methyltransferase

97 Gene Product Result for
Synonyms: PEAMT PEMPT PEMT2 PNMT
Gene ID:
Human(10400) Summary: Phosphatidylcholine (PC) is the most abundant mammalian phospholipid. This gene encodes an enzyme which converts phosphatidylethanolamine to phosphatidylcholine by sequential methylation in the liver. Another distinct synthetic pathway in nucleated cells converts intracellular choline to phosphatidylcholine by a three-step process. The protein isoforms encoded by this gene localize to the endoplasmic reticulum and mitochondria-associated membranes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012]
Mouse(18618) phosphatidylethanolamine N-methyltransferase
Rat(25511) phosphatidylethanolamine N-methyltransferase
cow(360197) phosphatidylethanolamine N-methyltransferase
domestic guinea pig(100731090) phosphatidylethanolamine N-methyltransferase
naked mole-rat(101706125) phosphatidylethanolamine N-methyltransferase
Zebrafish(393127) phosphatidylethanolamine N-methyltransferase
dog(479526) phosphatidylethanolamine N-methyltransferase
chicken(416508) phosphatidylethanolamine N-methyltransferase
domestic cat(101088035) phosphatidylethanolamine N-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007169 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122571 MISSION® esiRNA esiRNA human PEMT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007169 Rosetta Predictions human pricing
NM_148172 Rosetta Predictions human pricing
NM_148173 Rosetta Predictions human pricing
NM_013003 Rosetta Predictions rat pricing
XM_001077338 Rosetta Predictions rat pricing
XM_001078986 Rosetta Predictions rat pricing
NM_008819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087060 predicted 694
2 SASI_Hs01_00087061 predicted 692
3 SASI_Hs02_00343103 predicted 723
4 SASI_Hs01_00087062 predicted 777
5 SASI_Hs02_00343104 predicted 755
6 SASI_Hs01_00087063 predicted 531
7 SASI_Hs01_00087064 predicted 516
8 SASI_Hs01_00087065 predicted 521
9 SASI_Hs01_00087066 predicted 689
10 SASI_Hs01_00087067 predicted 718
11 SASI_Hs01_00087068 predicted 519
12 SASI_Hs01_00087069 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201413 predicted 678
2 SASI_Hs01_00201414 predicted 677
3 SASI_Hs02_00365558 predicted 702
4 SASI_Hs01_00201415 predicted 760
5 SASI_Hs02_00365559 predicted 742
6 SASI_Hs01_00201416 predicted 519
7 SASI_Hs01_00201417 predicted 500
8 SASI_Hs01_00201418 predicted 504
9 SASI_Hs01_00201419 predicted 678
10 SASI_Hs01_00201420 predicted 700
11 SASI_Hs01_00201421 predicted 506
12 SASI_Hs01_00201422 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090197 predicted 572
2 SASI_Hs01_00090198 predicted 581
3 SASI_Hs02_00365560 predicted 610
4 SASI_Hs01_00090199 predicted 663
5 SASI_Hs02_00365561 predicted 642
6 SASI_Hs01_00090200 predicted 416
7 SASI_Hs01_00090201 predicted 404
8 SASI_Hs01_00090202 predicted 405
9 SASI_Hs01_00090203 predicted 585
10 SASI_Hs01_00090204 predicted 611
11 SASI_Hs01_00090205 predicted 410
12 SASI_Hs01_00090206 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260659 predicted 609
2 SASI_Rn01_00053474 predicted 310
3 SASI_Rn01_00053475 predicted 308
4 SASI_Rn01_00053477 predicted 567
5 SASI_Rn02_00260660 predicted 546
6 SASI_Rn02_00260661 predicted 627
7 SASI_Rn01_00053478 predicted 535
8 SASI_Rn01_00053481 predicted 435
9 SASI_Rn01_00053482 predicted 465
10 SASI_Rn01_00053483 predicted 473
11 SASI_Rn01_00053476 predicted 439
12 SASI_Rn01_00053479 predicted 535
13 SASI_Rn01_00053480 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356692 predicted 349
2 SASI_Rn02_00356693 predicted 343
3 SASI_Rn02_00356694 predicted 218
4 SASI_Rn02_00356695 predicted 233
5 SASI_Rn02_00356696 predicted 377
6 SASI_Rn02_00356697 predicted 333
7 SASI_Rn02_00356698 predicted 225
8 SASI_Rn02_00356699 predicted 303
9 SASI_Rn02_00356700 predicted 235
10 SASI_Rn02_00356701 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362735 predicted 213
2 SASI_Rn02_00362736 predicted 5
3 SASI_Rn02_00362737 predicted 131
4 SASI_Rn02_00362738 predicted 235
5 SASI_Rn02_00362739 predicted 215
6 SASI_Rn02_00362740 predicted 247
7 SASI_Rn02_00362741 predicted 4
8 SASI_Rn02_00362742 predicted 182
9 SASI_Rn02_00362743 predicted 9
10 SASI_Rn02_00362744 predicted 89
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036400 predicted 575
2 SASI_Mm01_00036401 predicted 550
3 SASI_Mm02_00314755 predicted 545
4 SASI_Mm01_00036402 predicted 245
5 SASI_Mm01_00036403 predicted 593
6 SASI_Mm02_00314756 predicted 569
7 SASI_Mm01_00036406 predicted 333
8 SASI_Mm01_00036407 predicted 372
9 SASI_Mm01_00036408 predicted 293
10 SASI_Mm01_00036409 predicted 493
11 SASI_Mm01_00036404 predicted 581
12 SASI_Mm01_00036405 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008819
VALIDATED
PEMT MISSION shRNA Bacterial Glycerol Stock
phosphatidylethanolamine N-methyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008819.2-551s21c1
Sequence:CCGGACGTGGTTGCTCTCCTATATGCTCGAGCATATAGGAGAGCAACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008819.2-526s21c1
Sequence:CCGGTTGACGGTGCTGGTGGCAATTCTCGAGAATTGCCACCAGCACCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008819.2-378s21c1
Sequence:CCGGGACCTTTCTAGGTGACTACTTCTCGAGAAGTAGTCACCTAGAAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008819.2-412s21c1
Sequence:CCGGGAGTCCAGAGTGACCACATTTCTCGAGAAATGTGGTCACTCTGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008819.2-634s21c1
Sequence:CCGGCAGGGCCATGAAGGATCTTTGCTCGAGCAAAGATCCTTCATGGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008819.2-638s1c1
Sequence:CCGGGCCATGAAGGATCTTTGGAAACTCGAGTTTCCAAAGATCCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008819.2-586s1c1
Sequence:CCGGGCTGAGATCTACCGACAGAAACTCGAGTTTCTGTCGGTAGATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008819.2-375s1c1
Sequence:CCGGTGGGACCTTTCTAGGTGACTACTCGAGTAGTCACCTAGAAAGGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008819.2-378s1c1
Sequence:CCGGGACCTTTCTAGGTGACTACTTCTCGAGAAGTAGTCACCTAGAAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008819.2-96s1c1
Sequence:CCGGCATTGTGTTCAACCCACTCTTCTCGAGAAGAGTGGGTTGAACACAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008819
VALIDATED
PEMT MISSION shRNA shRNA Plasmid DNA
phosphatidylethanolamine N-methyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008819.2-551s21c1
Sequence:CCGGACGTGGTTGCTCTCCTATATGCTCGAGCATATAGGAGAGCAACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008819.2-526s21c1
Sequence:CCGGTTGACGGTGCTGGTGGCAATTCTCGAGAATTGCCACCAGCACCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008819.2-378s21c1
Sequence:CCGGGACCTTTCTAGGTGACTACTTCTCGAGAAGTAGTCACCTAGAAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008819.2-412s21c1
Sequence:CCGGGAGTCCAGAGTGACCACATTTCTCGAGAAATGTGGTCACTCTGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008819.2-634s21c1
Sequence:CCGGCAGGGCCATGAAGGATCTTTGCTCGAGCAAAGATCCTTCATGGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008819.2-638s1c1
Sequence:CCGGGCCATGAAGGATCTTTGGAAACTCGAGTTTCCAAAGATCCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008819.2-586s1c1
Sequence:CCGGGCTGAGATCTACCGACAGAAACTCGAGTTTCTGTCGGTAGATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008819.2-375s1c1
Sequence:CCGGTGGGACCTTTCTAGGTGACTACTCGAGTAGTCACCTAGAAAGGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008819.2-378s1c1
Sequence:CCGGGACCTTTCTAGGTGACTACTTCTCGAGAAGTAGTCACCTAGAAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008819.2-96s1c1
Sequence:CCGGCATTGTGTTCAACCCACTCTTCTCGAGAAGAGTGGGTTGAACACAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008819
VALIDATED
PEMT MISSION shRNA Lentiviral Transduction Particles
phosphatidylethanolamine N-methyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008819.2-551s21c1
Sequence:CCGGACGTGGTTGCTCTCCTATATGCTCGAGCATATAGGAGAGCAACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008819.2-526s21c1
Sequence:CCGGTTGACGGTGCTGGTGGCAATTCTCGAGAATTGCCACCAGCACCGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008819.2-378s21c1
Sequence:CCGGGACCTTTCTAGGTGACTACTTCTCGAGAAGTAGTCACCTAGAAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008819.2-412s21c1
Sequence:CCGGGAGTCCAGAGTGACCACATTTCTCGAGAAATGTGGTCACTCTGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008819.2-634s21c1
Sequence:CCGGCAGGGCCATGAAGGATCTTTGCTCGAGCAAAGATCCTTCATGGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008819.2-638s1c1
Sequence:CCGGGCCATGAAGGATCTTTGGAAACTCGAGTTTCCAAAGATCCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008819.2-586s1c1
Sequence:CCGGGCTGAGATCTACCGACAGAAACTCGAGTTTCTGTCGGTAGATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008819.2-375s1c1
Sequence:CCGGTGGGACCTTTCTAGGTGACTACTCGAGTAGTCACCTAGAAAGGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008819.2-378s1c1
Sequence:CCGGGACCTTTCTAGGTGACTACTTCTCGAGAAGTAGTCACCTAGAAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008819.2-96s1c1
Sequence:CCGGCATTGTGTTCAACCCACTCTTCTCGAGAAGAGTGGGTTGAACACAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007169
VALIDATED
PEMT MISSION shRNA Bacterial Glycerol Stock
phosphatidylethanolamine N-methyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-688s21c1
Sequence:CCGGGCCCTCACCTACATAGTGGCTCTCGAGAGCCACTATGTAGGTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-531s21c1
Sequence:CCGGCCTAGGTGATTACTTCGGGATCTCGAGATCCCGAAGTAATCACCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-339s21c1
Sequence:CCGGCTACTCTCTAAGCGTCACCATCTCGAGATGGTGACGCTTAGAGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-339s1c1
Sequence:CCGGCTACTCTCTAAGCGTCACCATCTCGAGATGGTGACGCTTAGAGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-256s1c1
Sequence:CCGGCCGCTCTACTGGAATGTGGTTCTCGAGAACCACATTCCAGTAGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-733s21c1
Sequence:CCGGGCTGAGATCTACCGGCAGAAACTCGAGTTTCTGCCGGTAGATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-531s1c1
Sequence:CCGGCCTAGGTGATTACTTCGGGATCTCGAGATCCCGAAGTAATCACCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-733s1c1
Sequence:CCGGGCTGAGATCTACCGGCAGAAACTCGAGTTTCTGCCGGTAGATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007169.2-688s1c1
Sequence:CCGGGCCCTCACCTACATAGTGGCTCTCGAGAGCCACTATGTAGGTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-256s21c1
Sequence:CCGGCCGCTCTACTGGAATGTGGTTCTCGAGAACCACATTCCAGTAGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007169
VALIDATED
PEMT MISSION shRNA shRNA Plasmid DNA
phosphatidylethanolamine N-methyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-688s21c1
Sequence:CCGGGCCCTCACCTACATAGTGGCTCTCGAGAGCCACTATGTAGGTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-531s21c1
Sequence:CCGGCCTAGGTGATTACTTCGGGATCTCGAGATCCCGAAGTAATCACCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-339s21c1
Sequence:CCGGCTACTCTCTAAGCGTCACCATCTCGAGATGGTGACGCTTAGAGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-339s1c1
Sequence:CCGGCTACTCTCTAAGCGTCACCATCTCGAGATGGTGACGCTTAGAGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-256s1c1
Sequence:CCGGCCGCTCTACTGGAATGTGGTTCTCGAGAACCACATTCCAGTAGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-733s21c1
Sequence:CCGGGCTGAGATCTACCGGCAGAAACTCGAGTTTCTGCCGGTAGATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-531s1c1
Sequence:CCGGCCTAGGTGATTACTTCGGGATCTCGAGATCCCGAAGTAATCACCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-733s1c1
Sequence:CCGGGCTGAGATCTACCGGCAGAAACTCGAGTTTCTGCCGGTAGATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007169.2-688s1c1
Sequence:CCGGGCCCTCACCTACATAGTGGCTCTCGAGAGCCACTATGTAGGTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-256s21c1
Sequence:CCGGCCGCTCTACTGGAATGTGGTTCTCGAGAACCACATTCCAGTAGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007169
VALIDATED
PEMT MISSION shRNA Lentiviral Transduction Particles
phosphatidylethanolamine N-methyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-688s21c1
Sequence:CCGGGCCCTCACCTACATAGTGGCTCTCGAGAGCCACTATGTAGGTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-531s21c1
Sequence:CCGGCCTAGGTGATTACTTCGGGATCTCGAGATCCCGAAGTAATCACCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-339s21c1
Sequence:CCGGCTACTCTCTAAGCGTCACCATCTCGAGATGGTGACGCTTAGAGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-339s1c1
Sequence:CCGGCTACTCTCTAAGCGTCACCATCTCGAGATGGTGACGCTTAGAGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-256s1c1
Sequence:CCGGCCGCTCTACTGGAATGTGGTTCTCGAGAACCACATTCCAGTAGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-733s21c1
Sequence:CCGGGCTGAGATCTACCGGCAGAAACTCGAGTTTCTGCCGGTAGATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-531s1c1
Sequence:CCGGCCTAGGTGATTACTTCGGGATCTCGAGATCCCGAAGTAATCACCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_007169.2-733s1c1
Sequence:CCGGGCTGAGATCTACCGGCAGAAACTCGAGTTTCTGCCGGTAGATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007169.2-688s1c1
Sequence:CCGGGCCCTCACCTACATAGTGGCTCTCGAGAGCCACTATGTAGGTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007169.2-256s21c1
Sequence:CCGGCCGCTCTACTGGAATGTGGTTCTCGAGAACCACATTCCAGTAGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)