EMAIL THIS PAGE TO A FRIEND

PENK

proenkephalin

48 Gene Product Result for
UniProtKB ID: P01210, B2RC23, Q6FHC6, Q6FHE6
Gene ID:
Mouse(18619) preproenkephalin
Rat(29237) proenkephalin
chicken(421131) proenkephalin
dog(100687307) proenkephalin
dog(477889) proenkephalin
domestic cat(768277) proenkephalin
domestic cat(101098113) proenkephalin
cow(281387) proenkephalin
sheep(100294557) proenkephalin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006211 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006211 Rosetta Predictions human pricing
NM_017139 Rosetta Predictions rat pricing
NM_001002927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201727 predicted 220
2 SASI_Hs01_00201728 predicted 345
3 SASI_Hs01_00201729 predicted 456
4 SASI_Hs01_00201730 predicted 197
5 SASI_Hs01_00201731 predicted 930
6 SASI_Hs01_00201732 predicted 974
7 SASI_Hs01_00201733 predicted 519
8 SASI_Hs01_00201734 predicted 284
9 SASI_Hs02_00341120 predicted 914
10 SASI_Hs01_00201735 predicted 926
11 SASI_Hs01_00201736 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083281 predicted 1021
2 SASI_Rn01_00083282 predicted 544
3 SASI_Rn01_00083285 predicted 710
4 SASI_Rn01_00083286 predicted 821
5 SASI_Rn02_00261388 predicted 519
6 SASI_Rn01_00083287 predicted 1221
7 SASI_Rn01_00083288 predicted 694
8 SASI_Rn01_00083289 predicted 431
9 SASI_Rn01_00083290 predicted 1192
10 SASI_Rn02_00261389 predicted 639
11 SASI_Rn01_00083283 predicted 555
12 SASI_Rn01_00083284 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060897 predicted 701
2 SASI_Mm01_00060898 predicted 686
3 SASI_Mm01_00060899 predicted 1162
4 SASI_Mm01_00060900 predicted 409
5 SASI_Mm01_00060901 predicted 527
6 SASI_Mm02_00286313 predicted 754
7 SASI_Mm01_00060902 predicted 518
8 SASI_Mm01_00060904 predicted 822
9 SASI_Mm01_00060905 predicted 599
10 SASI_Mm01_00060906 predicted 1055
11 SASI_Mm01_00060903 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002927
PENK MISSION shRNA Bacterial Glycerol Stock
proenkephalin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-829s1c1
Sequence:CCGGGCACCAACAATGACGAAGACACTCGAGTGTCTTCGTCATTGTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-530s1c1
Sequence:CCGGCCCTTGGGATAACATCGACATCTCGAGATGTCGATGTTATCCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-1030s1c1
Sequence:CCGGCCTCCGATGAAGAAGGCGAAACTCGAGTTTCGCCTTCTTCATCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002927.1-1170s1c1
Sequence:CCGGGCCTTGTCAATGATGTTTCTTCTCGAGAAGAAACATCATTGACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-623s1c1
Sequence:CCGGCGGAGGCTTCATGAAGAAGATCTCGAGATCTTCTTCATGAAGCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002927
PENK MISSION shRNA shRNA Plasmid DNA
proenkephalin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-829s1c1
Sequence:CCGGGCACCAACAATGACGAAGACACTCGAGTGTCTTCGTCATTGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-530s1c1
Sequence:CCGGCCCTTGGGATAACATCGACATCTCGAGATGTCGATGTTATCCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-1030s1c1
Sequence:CCGGCCTCCGATGAAGAAGGCGAAACTCGAGTTTCGCCTTCTTCATCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002927.1-1170s1c1
Sequence:CCGGGCCTTGTCAATGATGTTTCTTCTCGAGAAGAAACATCATTGACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-623s1c1
Sequence:CCGGCGGAGGCTTCATGAAGAAGATCTCGAGATCTTCTTCATGAAGCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002927
PENK MISSION shRNA Lentiviral Transduction Particles
proenkephalin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-829s1c1
Sequence:CCGGGCACCAACAATGACGAAGACACTCGAGTGTCTTCGTCATTGTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-530s1c1
Sequence:CCGGCCCTTGGGATAACATCGACATCTCGAGATGTCGATGTTATCCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-1030s1c1
Sequence:CCGGCCTCCGATGAAGAAGGCGAAACTCGAGTTTCGCCTTCTTCATCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002927.1-1170s1c1
Sequence:CCGGGCCTTGTCAATGATGTTTCTTCTCGAGAAGAAACATCATTGACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002927.1-623s1c1
Sequence:CCGGCGGAGGCTTCATGAAGAAGATCTCGAGATCTTCTTCATGAAGCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006211
PENK MISSION shRNA Bacterial Glycerol Stock
proenkephalin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-344s1c1
Sequence:CCGGCCGGAAGAAAGCCATTTGCTACTCGAGTAGCAAATGGCTTTCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006211.2-975s1c1
Sequence:CCGGCCTTGTATAGTTGACTTCATTCTCGAGAATGAAGTCAACTATACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-215s1c1
Sequence:CCGGGCTTGCGTAATGGAATGTGAACTCGAGTTCACATTCCATTACGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-805s1c1
Sequence:CCGGCGACGAAGAAGGCGAAAGTTACTCGAGTAACTTTCGCCTTCTTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-804s1c1
Sequence:CCGGCCGACGAAGAAGGCGAAAGTTCTCGAGAACTTTCGCCTTCTTCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006211.3-619s21c1
Sequence:CCGGGAAGAAGTGAGCAAGAGATATCTCGAGATATCTCTTGCTCACTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006211.3-534s21c1
Sequence:CCGGCAATTCCTCAGACCTGCTAAACTCGAGTTTAGCAGGTCTGAGGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006211.3-643s21c1
Sequence:CCGGGGCTTCATGAGAGGCTTAAAGCTCGAGCTTTAAGCCTCTCATGAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006211.3-1064s21c1
Sequence:CCGGTAAGCTCAGTATTAGTCTATTCTCGAGAATAGACTAATACTGAGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006211
PENK MISSION shRNA shRNA Plasmid DNA
proenkephalin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-344s1c1
Sequence:CCGGCCGGAAGAAAGCCATTTGCTACTCGAGTAGCAAATGGCTTTCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006211.2-975s1c1
Sequence:CCGGCCTTGTATAGTTGACTTCATTCTCGAGAATGAAGTCAACTATACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-215s1c1
Sequence:CCGGGCTTGCGTAATGGAATGTGAACTCGAGTTCACATTCCATTACGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-805s1c1
Sequence:CCGGCGACGAAGAAGGCGAAAGTTACTCGAGTAACTTTCGCCTTCTTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-804s1c1
Sequence:CCGGCCGACGAAGAAGGCGAAAGTTCTCGAGAACTTTCGCCTTCTTCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006211.3-619s21c1
Sequence:CCGGGAAGAAGTGAGCAAGAGATATCTCGAGATATCTCTTGCTCACTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006211.3-534s21c1
Sequence:CCGGCAATTCCTCAGACCTGCTAAACTCGAGTTTAGCAGGTCTGAGGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006211.3-643s21c1
Sequence:CCGGGGCTTCATGAGAGGCTTAAAGCTCGAGCTTTAAGCCTCTCATGAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006211.3-1064s21c1
Sequence:CCGGTAAGCTCAGTATTAGTCTATTCTCGAGAATAGACTAATACTGAGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006211
PENK MISSION shRNA Lentiviral Transduction Particles
proenkephalin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-344s1c1
Sequence:CCGGCCGGAAGAAAGCCATTTGCTACTCGAGTAGCAAATGGCTTTCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006211.2-975s1c1
Sequence:CCGGCCTTGTATAGTTGACTTCATTCTCGAGAATGAAGTCAACTATACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-215s1c1
Sequence:CCGGGCTTGCGTAATGGAATGTGAACTCGAGTTCACATTCCATTACGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-805s1c1
Sequence:CCGGCGACGAAGAAGGCGAAAGTTACTCGAGTAACTTTCGCCTTCTTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006211.2-804s1c1
Sequence:CCGGCCGACGAAGAAGGCGAAAGTTCTCGAGAACTTTCGCCTTCTTCGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006211.3-619s21c1
Sequence:CCGGGAAGAAGTGAGCAAGAGATATCTCGAGATATCTCTTGCTCACTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006211.3-534s21c1
Sequence:CCGGCAATTCCTCAGACCTGCTAAACTCGAGTTTAGCAGGTCTGAGGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006211.3-643s21c1
Sequence:CCGGGGCTTCATGAGAGGCTTAAAGCTCGAGCTTTAAGCCTCTCATGAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006211.3-1064s21c1
Sequence:CCGGTAAGCTCAGTATTAGTCTATTCTCGAGAATAGACTAATACTGAGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)