EMAIL THIS PAGE TO A FRIEND

PER2

period circadian clock 2

104 Gene Product Result for
Synonyms: FASPS FASPS1
UniProtKB ID: O15055, A2I2P7, Q4ZG49, Q9UQ45
Gene ID:
Human(8864) Summary: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. Circadian expression in the suprachiasmatic nucleus continues in constant darkness, and a shift in the light/dark cycle evokes a proportional shift of gene expression in the suprachiasmatic nucleus. The specific function of this gene is not yet known. [provided by RefSeq, Jul 2008]
Mouse(18627) period circadian clock 2
Rat(63840) period circadian clock 2
Zebrafish(140633) period homolog 2 (Drosophila)
chicken(374116) period homolog 2 (Drosophila)
domestic cat(101088352) period homolog 2 (Drosophila)
Horse(100034167) period homolog 2 (Drosophila)
dog(486180) period homolog 2 (Drosophila)
domestic guinea pig(100713579) period circadian clock 2
naked mole-rat(101724066) period circadian clock 2
cow(512237) period circadian clock 2
sheep(443259) period homolog 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022817 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003894 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003894 Rosetta Predictions human pricing
NM_022817 Rosetta Predictions human pricing
NM_031678 Rosetta Predictions rat pricing
NM_011066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193378 predicted 424
2 SASI_Hs01_00193379 predicted 740
3 SASI_Hs01_00193380 predicted 564
4 SASI_Hs01_00193381 predicted 398
5 SASI_Hs01_00193382 predicted 739
6 SASI_Hs01_00193383 predicted 520
7 SASI_Hs01_00193384 predicted 443
8 SASI_Hs01_00193385 predicted 790
9 SASI_Hs01_00193386 predicted 821
10 SASI_Hs01_00193387 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356110 predicted 2505
2 SASI_Hs02_00356111 predicted 2940
3 SASI_Hs01_00125026 predicted 539
4 SASI_Hs02_00356112 predicted 2061
5 SASI_Hs02_00356113 predicted 2788
6 SASI_Hs02_00356114 predicted 3522
7 SASI_Hs01_00125029 predicted 508
8 SASI_Hs02_00356115 predicted 1441
9 SASI_Hs02_00356116 predicted 2505
10 SASI_Hs02_00356117 predicted 2633
11 SASI_Hs01_00125027 predicted 748
12 SASI_Hs01_00125028 predicted 567
13 SASI_Hs01_00125030 predicted 740
14 SASI_Hs01_00125031 predicted 513
15 SASI_Hs01_00125032 predicted 439
16 SASI_Hs01_00125033 predicted 789
17 SASI_Hs01_00125034 predicted 821
18 SASI_Hs01_00125035 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037881 predicted 1049
2 SASI_Rn02_00265023 predicted 655
3 SASI_Rn01_00037882 predicted 628
4 SASI_Rn01_00037883 predicted 1272
5 SASI_Rn01_00037884 predicted 3052
6 SASI_Rn01_00037885 predicted 3751
7 SASI_Rn01_00037886 predicted 1325
8 SASI_Rn01_00037887 predicted 1063
9 SASI_Rn01_00037888 predicted 3476
10 SASI_Rn02_00265024 predicted 1095
11 SASI_Rn01_00037880 predicted 3401
12 SASI_Rn01_00037889 predicted 2835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028533 predicted 2953
2 SASI_Mm02_00319833 predicted 390
3 SASI_Mm01_00028534 predicted 1117
4 SASI_Mm01_00028532 predicted 2323
5 SASI_Mm01_00028535 predicted 724
6 SASI_Mm01_00028536 predicted 3608
7 SASI_Mm01_00028537 predicted 2455
8 SASI_Mm02_00319834 predicted 1377
9 SASI_Mm01_00028538 predicted 3551
10 SASI_Mm01_00028539 predicted 3787
11 SASI_Mm01_00028540 predicted 1136
12 SASI_Mm01_00028541 predicted 1804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022817
VALIDATED
PER2 MISSION shRNA Bacterial Glycerol Stock
period circadian clock 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022817.2-4401s21c1
Sequence:CCGGGTGTTTGGATCAGATCAAATTCTCGAGAATTTGATCTGATCCAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022817.2-3690s21c1
Sequence:CCGGCCAGCTGCCTTCCCGAAATTTCTCGAGAAATTTCGGGAAGGCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_022817.2-1074s21c1
Sequence:CCGGCCACGAGAATGAAATCCGCTACTCGAGTAGCGGATTTCATTCTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022817.2-461s21c1
Sequence:CCGGGCCAGAGTCCAGATACCTTTACTCGAGTAAAGGTATCTGGACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022817.2-861s21c1
Sequence:CCGGTGACCAGGTTGCATCCATATTCTCGAGAATATGGATGCAACCTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022817
VALIDATED
PER2 MISSION shRNA shRNA Plasmid DNA
period circadian clock 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022817.2-4401s21c1
Sequence:CCGGGTGTTTGGATCAGATCAAATTCTCGAGAATTTGATCTGATCCAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022817.2-3690s21c1
Sequence:CCGGCCAGCTGCCTTCCCGAAATTTCTCGAGAAATTTCGGGAAGGCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_022817.2-1074s21c1
Sequence:CCGGCCACGAGAATGAAATCCGCTACTCGAGTAGCGGATTTCATTCTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022817.2-461s21c1
Sequence:CCGGGCCAGAGTCCAGATACCTTTACTCGAGTAAAGGTATCTGGACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022817.2-861s21c1
Sequence:CCGGTGACCAGGTTGCATCCATATTCTCGAGAATATGGATGCAACCTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022817
VALIDATED
PER2 MISSION shRNA Lentiviral Transduction Particles
period circadian clock 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022817.2-4401s21c1
Sequence:CCGGGTGTTTGGATCAGATCAAATTCTCGAGAATTTGATCTGATCCAAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022817.2-3690s21c1
Sequence:CCGGCCAGCTGCCTTCCCGAAATTTCTCGAGAAATTTCGGGAAGGCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_022817.2-1074s21c1
Sequence:CCGGCCACGAGAATGAAATCCGCTACTCGAGTAGCGGATTTCATTCTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022817.2-461s21c1
Sequence:CCGGGCCAGAGTCCAGATACCTTTACTCGAGTAAAGGTATCTGGACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022817.2-861s21c1
Sequence:CCGGTGACCAGGTTGCATCCATATTCTCGAGAATATGGATGCAACCTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011066
PER2 MISSION shRNA Bacterial Glycerol Stock
period circadian clock 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011066.3-2461s21c1
Sequence:CCGGAGTGATCGAGGACTAAGAAATCTCGAGATTTCTTAGTCCTCGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011066.3-705s21c1
Sequence:CCGGGGGCATTACCTCCGAGTATATCTCGAGATATACTCGGAGGTAATGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011066.3-485s21c1
Sequence:CCGGACGCACACAAAGAACTGATAACTCGAGTTATCAGTTCTTTGTGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011066.3-5456s21c1
Sequence:CCGGTGTTTACCATCAGCGTTATTTCTCGAGAAATAACGCTGATGGTAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011066.1-5375s1c1
Sequence:CCGGCGCTTGTTACTTAAACACAAACTCGAGTTTGTGTTTAAGTAACAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-1854s1c1
Sequence:CCGGCCCAGAGGAACTAGCCTATAACTCGAGTTATAGGCTAGTTCCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-1276s1c1
Sequence:CCGGGCCATCCACAAGAAGATCCTACTCGAGTAGGATCTTCTTGTGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-3525s1c1
Sequence:CCGGGCAGTTCATTAAGTACGTCTTCTCGAGAAGACGTACTTAATGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-1311s1c1
Sequence:CCGGGCCTTTCGATTATTCTCCCATCTCGAGATGGGAGAATAATCGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011066
PER2 MISSION shRNA shRNA Plasmid DNA
period circadian clock 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011066.3-2461s21c1
Sequence:CCGGAGTGATCGAGGACTAAGAAATCTCGAGATTTCTTAGTCCTCGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011066.3-705s21c1
Sequence:CCGGGGGCATTACCTCCGAGTATATCTCGAGATATACTCGGAGGTAATGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011066.3-485s21c1
Sequence:CCGGACGCACACAAAGAACTGATAACTCGAGTTATCAGTTCTTTGTGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011066.3-5456s21c1
Sequence:CCGGTGTTTACCATCAGCGTTATTTCTCGAGAAATAACGCTGATGGTAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011066.1-5375s1c1
Sequence:CCGGCGCTTGTTACTTAAACACAAACTCGAGTTTGTGTTTAAGTAACAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-1854s1c1
Sequence:CCGGCCCAGAGGAACTAGCCTATAACTCGAGTTATAGGCTAGTTCCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-1276s1c1
Sequence:CCGGGCCATCCACAAGAAGATCCTACTCGAGTAGGATCTTCTTGTGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-3525s1c1
Sequence:CCGGGCAGTTCATTAAGTACGTCTTCTCGAGAAGACGTACTTAATGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-1311s1c1
Sequence:CCGGGCCTTTCGATTATTCTCCCATCTCGAGATGGGAGAATAATCGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011066
PER2 MISSION shRNA Lentiviral Transduction Particles
period circadian clock 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011066.3-2461s21c1
Sequence:CCGGAGTGATCGAGGACTAAGAAATCTCGAGATTTCTTAGTCCTCGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011066.3-705s21c1
Sequence:CCGGGGGCATTACCTCCGAGTATATCTCGAGATATACTCGGAGGTAATGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011066.3-485s21c1
Sequence:CCGGACGCACACAAAGAACTGATAACTCGAGTTATCAGTTCTTTGTGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011066.3-5456s21c1
Sequence:CCGGTGTTTACCATCAGCGTTATTTCTCGAGAAATAACGCTGATGGTAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011066.1-5375s1c1
Sequence:CCGGCGCTTGTTACTTAAACACAAACTCGAGTTTGTGTTTAAGTAACAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-1854s1c1
Sequence:CCGGCCCAGAGGAACTAGCCTATAACTCGAGTTATAGGCTAGTTCCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-1276s1c1
Sequence:CCGGGCCATCCACAAGAAGATCCTACTCGAGTAGGATCTTCTTGTGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-3525s1c1
Sequence:CCGGGCAGTTCATTAAGTACGTCTTCTCGAGAAGACGTACTTAATGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011066.1-1311s1c1
Sequence:CCGGGCCTTTCGATTATTCTCCCATCTCGAGATGGGAGAATAATCGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003894
VALIDATED
PER2 MISSION shRNA Bacterial Glycerol Stock
period circadian clock 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003894.3-756s1c1
Sequence:CCGGGCATCCATATTTCACTGTAAACTCGAGTTTACAGTGAAATATGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003894.3-346s1c1
Sequence:CCGGGCCAGAGTCCAGATACCTTTACTCGAGTAAAGGTATCTGGACTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003894.3-438s1c1
Sequence:CCGGGACACACACAAAGAACTGATACTCGAGTATCAGTTCTTTGTGTGTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003894.3-959s1c1
Sequence:CCGGCCACGAGAATGAAATCCGCTACTCGAGTAGCGGATTTCATTCTCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003894.3-1137s1c1
Sequence:CCGGCCAAATTGTTTGTTCCAGGATCTCGAGATCCTGGAACAAACAATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003894
VALIDATED
PER2 MISSION shRNA shRNA Plasmid DNA
period circadian clock 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003894.3-756s1c1
Sequence:CCGGGCATCCATATTTCACTGTAAACTCGAGTTTACAGTGAAATATGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003894.3-346s1c1
Sequence:CCGGGCCAGAGTCCAGATACCTTTACTCGAGTAAAGGTATCTGGACTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003894.3-438s1c1
Sequence:CCGGGACACACACAAAGAACTGATACTCGAGTATCAGTTCTTTGTGTGTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003894.3-959s1c1
Sequence:CCGGCCACGAGAATGAAATCCGCTACTCGAGTAGCGGATTTCATTCTCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003894.3-1137s1c1
Sequence:CCGGCCAAATTGTTTGTTCCAGGATCTCGAGATCCTGGAACAAACAATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003894
VALIDATED
PER2 MISSION shRNA Lentiviral Transduction Particles
period circadian clock 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003894.3-756s1c1
Sequence:CCGGGCATCCATATTTCACTGTAAACTCGAGTTTACAGTGAAATATGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003894.3-346s1c1
Sequence:CCGGGCCAGAGTCCAGATACCTTTACTCGAGTAAAGGTATCTGGACTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003894.3-438s1c1
Sequence:CCGGGACACACACAAAGAACTGATACTCGAGTATCAGTTCTTTGTGTGTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003894.3-959s1c1
Sequence:CCGGCCACGAGAATGAAATCCGCTACTCGAGTAGCGGATTTCATTCTCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003894.3-1137s1c1
Sequence:CCGGCCAAATTGTTTGTTCCAGGATCTCGAGATCCTGGAACAAACAATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)