EMAIL THIS PAGE TO A FRIEND

PER3

period circadian clock 3

78 Gene Product Result for
Synonyms: GIG13
Gene ID:
Human(8863) Summary: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. Circadian expression in the suprachiasmatic nucleus continues in constant darkness, and a shift in the light/dark cycle evokes a proportional shift of gene expression in the suprachiasmatic nucleus. The specific function of this gene is not yet known. [provided by RefSeq, Jul 2008]
Mouse(18628) period circadian clock 3
Rat(78962) period circadian clock 3
Zebrafish(58107) period homolog 3 (Drosophila)
Horse(100630305) period homolog 3 (Drosophila)
dog(608256) period homolog 3 (Drosophila)
chicken(419366) period homolog 3 (Drosophila)
cow(614154) period circadian clock 3
naked mole-rat(101709352) period circadian clock 3
domestic guinea pig(100731201) period circadian clock 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016831 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016831 Rosetta Predictions human pricing
NM_023978 Rosetta Predictions rat pricing
NM_011067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089632 predicted 686
2 SASI_Hs01_00089633 predicted 2049
3 SASI_Hs01_00089634 predicted 503
4 SASI_Hs01_00089635 predicted 3430
5 SASI_Hs01_00089636 predicted 1551
6 SASI_Hs01_00089637 predicted 1216
7 SASI_Hs01_00089638 predicted 3810
8 SASI_Hs02_00349896 predicted 1278
9 SASI_Hs01_00089640 predicted 1975
10 SASI_Hs02_00349897 predicted 1925
11 SASI_Hs01_00089631 predicted 3794
12 SASI_Hs01_00089639 predicted 3227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100162 predicted 383
2 SASI_Rn01_00100163 predicted 732
3 SASI_Rn02_00263799 predicted 2780
4 SASI_Rn01_00100166 predicted 781
5 SASI_Rn01_00100167 predicted 754
6 SASI_Rn01_00100168 predicted 2283
7 SASI_Rn01_00100169 predicted 2481
8 SASI_Rn01_00100170 predicted 1373
9 SASI_Rn02_00263800 predicted 2900
10 SASI_Rn01_00100171 predicted 2686
11 SASI_Rn01_00100164 predicted 1637
12 SASI_Rn01_00100165 predicted 2896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170974 predicted 1122
2 SASI_Mm01_00170975 predicted 3809
3 SASI_Mm01_00170976 predicted 1170
4 SASI_Mm01_00170977 predicted 3782
5 SASI_Mm01_00170978 predicted 3792
6 SASI_Mm02_00319835 predicted 3085
7 SASI_Mm01_00170979 predicted 773
8 SASI_Mm01_00170980 predicted 1275
9 SASI_Mm01_00170981 predicted 1928
10 SASI_Mm01_00170982 predicted 1144
11 SASI_Mm01_00170983 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016831
VALIDATED
PER3 MISSION shRNA Bacterial Glycerol Stock
period circadian clock 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-3161s1c1
Sequence:CCGGCCCATGAAGAATCCATCCCATCTCGAGATGGGATGGATTCTTCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-539s1c1
Sequence:CCGGGCTTCAGAACACACTTCCAAACTCGAGTTTGGAAGTGTGTTCTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-1768s1c1
Sequence:CCGGCCCATCCTATCAACAGATCAACTCGAGTTGATCTGTTGATAGGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016831.1-3641s1c1
Sequence:CCGGGCTAAGGTGTATAATTGGATTCTCGAGAATCCAATTATACACCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-3018s1c1
Sequence:CCGGCGTGCCCACAAACTGAGTATTCTCGAGAATACTCAGTTTGTGGGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016831.1-539s21c1
Sequence:CCGGGCTTCAGAACACACTTCCAAACTCGAGTTTGGAAGTGTGTTCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016831.1-374s21c1
Sequence:CCGGCCCTCGGAGAGACGCAATAAACTCGAGTTTATTGCGTCTCTCCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016831.1-2793s21c1
Sequence:CCGGCGACAGCCTCTTCTGCGATATCTCGAGATATCGCAGAAGAGGCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016831.1-3860s21c1
Sequence:CCGGATGACCATGAAGTTATCATTGCTCGAGCAATGATAACTTCATGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016831
VALIDATED
PER3 MISSION shRNA shRNA Plasmid DNA
period circadian clock 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-3161s1c1
Sequence:CCGGCCCATGAAGAATCCATCCCATCTCGAGATGGGATGGATTCTTCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-539s1c1
Sequence:CCGGGCTTCAGAACACACTTCCAAACTCGAGTTTGGAAGTGTGTTCTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-1768s1c1
Sequence:CCGGCCCATCCTATCAACAGATCAACTCGAGTTGATCTGTTGATAGGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016831.1-3641s1c1
Sequence:CCGGGCTAAGGTGTATAATTGGATTCTCGAGAATCCAATTATACACCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-3018s1c1
Sequence:CCGGCGTGCCCACAAACTGAGTATTCTCGAGAATACTCAGTTTGTGGGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016831.1-539s21c1
Sequence:CCGGGCTTCAGAACACACTTCCAAACTCGAGTTTGGAAGTGTGTTCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016831.1-374s21c1
Sequence:CCGGCCCTCGGAGAGACGCAATAAACTCGAGTTTATTGCGTCTCTCCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016831.1-2793s21c1
Sequence:CCGGCGACAGCCTCTTCTGCGATATCTCGAGATATCGCAGAAGAGGCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016831.1-3860s21c1
Sequence:CCGGATGACCATGAAGTTATCATTGCTCGAGCAATGATAACTTCATGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016831
VALIDATED
PER3 MISSION shRNA Lentiviral Transduction Particles
period circadian clock 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-3161s1c1
Sequence:CCGGCCCATGAAGAATCCATCCCATCTCGAGATGGGATGGATTCTTCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-539s1c1
Sequence:CCGGGCTTCAGAACACACTTCCAAACTCGAGTTTGGAAGTGTGTTCTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-1768s1c1
Sequence:CCGGCCCATCCTATCAACAGATCAACTCGAGTTGATCTGTTGATAGGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016831.1-3641s1c1
Sequence:CCGGGCTAAGGTGTATAATTGGATTCTCGAGAATCCAATTATACACCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016831.1-3018s1c1
Sequence:CCGGCGTGCCCACAAACTGAGTATTCTCGAGAATACTCAGTTTGTGGGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016831.1-539s21c1
Sequence:CCGGGCTTCAGAACACACTTCCAAACTCGAGTTTGGAAGTGTGTTCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016831.1-374s21c1
Sequence:CCGGCCCTCGGAGAGACGCAATAAACTCGAGTTTATTGCGTCTCTCCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016831.1-2793s21c1
Sequence:CCGGCGACAGCCTCTTCTGCGATATCTCGAGATATCGCAGAAGAGGCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016831.1-3860s21c1
Sequence:CCGGATGACCATGAAGTTATCATTGCTCGAGCAATGATAACTTCATGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011067
PER3 MISSION shRNA Bacterial Glycerol Stock
period circadian clock 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011067.1-4126s1c1
Sequence:CCGGCCCACTAGAATACTTGAAGAACTCGAGTTCTTCAAGTATTCTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-1725s1c1
Sequence:CCGGGCAGGTCTATGCCAGTGTAAACTCGAGTTTACACTGGCATAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-3086s1c1
Sequence:CCGGGTTCACCGTTACAGTTAAATTCTCGAGAATTTAACTGTAACGGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-1094s1c1
Sequence:CCGGGCTGTCTAACACTGGTTGAAACTCGAGTTTCAACCAGTGTTAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-1525s1c1
Sequence:CCGGGCCAGTAACGACAAAGACATACTCGAGTATGTCTTTGTCGTTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011067
PER3 MISSION shRNA shRNA Plasmid DNA
period circadian clock 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011067.1-4126s1c1
Sequence:CCGGCCCACTAGAATACTTGAAGAACTCGAGTTCTTCAAGTATTCTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-1725s1c1
Sequence:CCGGGCAGGTCTATGCCAGTGTAAACTCGAGTTTACACTGGCATAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-3086s1c1
Sequence:CCGGGTTCACCGTTACAGTTAAATTCTCGAGAATTTAACTGTAACGGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-1094s1c1
Sequence:CCGGGCTGTCTAACACTGGTTGAAACTCGAGTTTCAACCAGTGTTAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-1525s1c1
Sequence:CCGGGCCAGTAACGACAAAGACATACTCGAGTATGTCTTTGTCGTTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011067
PER3 MISSION shRNA Lentiviral Transduction Particles
period circadian clock 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011067.1-4126s1c1
Sequence:CCGGCCCACTAGAATACTTGAAGAACTCGAGTTCTTCAAGTATTCTAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-1725s1c1
Sequence:CCGGGCAGGTCTATGCCAGTGTAAACTCGAGTTTACACTGGCATAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-3086s1c1
Sequence:CCGGGTTCACCGTTACAGTTAAATTCTCGAGAATTTAACTGTAACGGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-1094s1c1
Sequence:CCGGGCTGTCTAACACTGGTTGAAACTCGAGTTTCAACCAGTGTTAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011067.1-1525s1c1
Sequence:CCGGGCCAGTAACGACAAAGACATACTCGAGTATGTCTTTGTCGTTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)