EMAIL THIS PAGE TO A FRIEND

PERP

PERP, TP53 apoptosis effector

97 Gene Product Result for
Synonyms: KCP1 KRTCAP1 PIGPC1 RP3-496H19.1 THW dJ496H19.1
Gene ID:
Mouse(64058) PERP, TP53 apoptosis effector
Rat(292949) PERP, TP53 apoptosis effector
Zebrafish(494479) PERP, TP53 apoptosis effector
dog(476218) PERP, TP53 apoptosis effector
Horse(100067837) PERP, TP53 apoptosis effector
domestic cat(101083938) PERP, TP53 apoptosis effector
chicken(421683) PERP, TP53 apoptosis effector
domestic guinea pig(100720226) PERP, TP53 apoptosis effector
naked mole-rat(101706602) PERP, TP53 apoptosis effector
cow(509485) PERP, TP53 apoptosis effector
sheep(101113683) PERP, TP53 apoptosis effector
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022121 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022121 Rosetta Predictions human pricing
NM_001106265 Rosetta Predictions rat pricing
NM_022032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192835 predicted 537
2 SASI_Hs01_00192838 predicted 682
3 SASI_Hs01_00192839 predicted 742
4 SASI_Hs01_00192840 predicted 671
5 SASI_Hs01_00192841 predicted 681
6 SASI_Hs01_00192842 predicted 408
7 SASI_Hs01_00192843 predicted 626
8 SASI_Hs01_00192844 predicted 339
9 SASI_Hs02_00355516 predicted 539
10 SASI_Hs02_00355517 predicted 588
11 SASI_Hs01_00192836 predicted 699
12 SASI_Hs01_00192837 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217268 predicted 582
2 SASI_Rn02_00217269 predicted 836
3 SASI_Rn02_00217270 predicted 896
4 SASI_Rn02_00217271 predicted 623
5 SASI_Rn02_00217272 predicted 848
6 SASI_Rn02_00217273 predicted 464
7 SASI_Rn02_00217274 predicted 496
8 SASI_Rn02_00217275 predicted 757
9 SASI_Rn02_00217276 predicted 787
10 SASI_Rn02_00217277 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326515 predicted 520
2 SASI_Mm02_00326516 predicted 521
3 SASI_Mm02_00326517 predicted 773
4 SASI_Mm01_00194138 predicted 542
5 SASI_Mm01_00194139 predicted 642
6 SASI_Mm02_00326518 predicted 257
7 SASI_Mm01_00194144 predicted 856
8 SASI_Mm01_00194147 predicted 769
9 SASI_Mm02_00326519 predicted 753
10 SASI_Mm02_00326520 predicted 783
11 SASI_Mm01_00194140 predicted 804
12 SASI_Mm01_00194141 predicted 941
13 SASI_Mm01_00194142 predicted 796
14 SASI_Mm01_00194143 predicted 547
15 SASI_Mm01_00194145 predicted 482
16 SASI_Mm01_00194146 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022121
VALIDATED
PERP MISSION shRNA Bacterial Glycerol Stock
PERP, TP53 apoptosis effector
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-1414s21c1
Sequence:CCGGGCTTTCCTTTAAGTGTGAAATCTCGAGATTTCACACTTAAAGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022121.2-1338s1c1
Sequence:CCGGGCTTTCCTTTAAGTGTGAAATCTCGAGATTTCACACTTAAAGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022121.2-537s1c1
Sequence:CCGGCCTGCTGTCACTTACATCTATCTCGAGATAGATGTAAGTGACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022121.2-473s1c1
Sequence:CCGGCCAGATCATCTCCCTGGTAATCTCGAGATTACCAGGGAGATGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022121.2-500s1c1
Sequence:CCGGCGTGAAGTACACCCAGACCTTCTCGAGAAGGTCTGGGTGTACTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022121.2-582s1c1
Sequence:CCGGGCAGCCACGATTATCCTGATTCTCGAGAATCAGGATAATCGTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-573s21c1
Sequence:CCGGCGTGAAGTACACCCAGACCTTCTCGAGAAGGTCTGGGTGTACTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-610s21c1
Sequence:CCGGCCTGCTGTCACTTACATCTATCTCGAGATAGATGTAAGTGACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-546s21c1
Sequence:CCGGCCAGATCATCTCCCTGGTAATCTCGAGATTACCAGGGAGATGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022121
VALIDATED
PERP MISSION shRNA shRNA Plasmid DNA
PERP, TP53 apoptosis effector
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-1414s21c1
Sequence:CCGGGCTTTCCTTTAAGTGTGAAATCTCGAGATTTCACACTTAAAGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022121.2-1338s1c1
Sequence:CCGGGCTTTCCTTTAAGTGTGAAATCTCGAGATTTCACACTTAAAGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022121.2-537s1c1
Sequence:CCGGCCTGCTGTCACTTACATCTATCTCGAGATAGATGTAAGTGACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022121.2-473s1c1
Sequence:CCGGCCAGATCATCTCCCTGGTAATCTCGAGATTACCAGGGAGATGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022121.2-500s1c1
Sequence:CCGGCGTGAAGTACACCCAGACCTTCTCGAGAAGGTCTGGGTGTACTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022121.2-582s1c1
Sequence:CCGGGCAGCCACGATTATCCTGATTCTCGAGAATCAGGATAATCGTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-573s21c1
Sequence:CCGGCGTGAAGTACACCCAGACCTTCTCGAGAAGGTCTGGGTGTACTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-610s21c1
Sequence:CCGGCCTGCTGTCACTTACATCTATCTCGAGATAGATGTAAGTGACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-546s21c1
Sequence:CCGGCCAGATCATCTCCCTGGTAATCTCGAGATTACCAGGGAGATGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022121
VALIDATED
PERP MISSION shRNA Lentiviral Transduction Particles
PERP, TP53 apoptosis effector
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-1414s21c1
Sequence:CCGGGCTTTCCTTTAAGTGTGAAATCTCGAGATTTCACACTTAAAGGAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022121.2-1338s1c1
Sequence:CCGGGCTTTCCTTTAAGTGTGAAATCTCGAGATTTCACACTTAAAGGAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022121.2-537s1c1
Sequence:CCGGCCTGCTGTCACTTACATCTATCTCGAGATAGATGTAAGTGACAGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022121.2-473s1c1
Sequence:CCGGCCAGATCATCTCCCTGGTAATCTCGAGATTACCAGGGAGATGATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022121.2-500s1c1
Sequence:CCGGCGTGAAGTACACCCAGACCTTCTCGAGAAGGTCTGGGTGTACTTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022121.2-582s1c1
Sequence:CCGGGCAGCCACGATTATCCTGATTCTCGAGAATCAGGATAATCGTGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-573s21c1
Sequence:CCGGCGTGAAGTACACCCAGACCTTCTCGAGAAGGTCTGGGTGTACTTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-610s21c1
Sequence:CCGGCCTGCTGTCACTTACATCTATCTCGAGATAGATGTAAGTGACAGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022121.4-546s21c1
Sequence:CCGGCCAGATCATCTCCCTGGTAATCTCGAGATTACCAGGGAGATGATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022032
VALIDATED
PERP MISSION shRNA Bacterial Glycerol Stock
PERP, TP53 apoptosis effector
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022032.1-602s1c1
Sequence:CCGGCCATCATCTTGATTGGTTGTTCTCGAGAACAACCAATCAAGATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022032.1-372s1c1
Sequence:CCGGTGGCTTTATCATCCTGTGCATCTCGAGATGCACAGGATGATAAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022032.1-599s1c1
Sequence:CCGGCCACCATCATCTTGATTGGTTCTCGAGAACCAATCAAGATGATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022032.1-1104s1c1
Sequence:CCGGCGTGACCAAATATCCTGAAATCTCGAGATTTCAGGATATTTGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022032.1-538s1c1
Sequence:CCGGCTTCACGATAACCCTGCTGTTCTCGAGAACAGCAGGGTTATCGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022032.4-392s21c1
Sequence:CCGGCTGCTTCATTCTCTCGTTCTTCTCGAGAAGAACGAGAGAATGAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022032.4-977s21c1
Sequence:CCGGGAAACTTGATAAGGTAGAAATCTCGAGATTTCTACCTTATCAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022032
VALIDATED
PERP MISSION shRNA shRNA Plasmid DNA
PERP, TP53 apoptosis effector
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022032.1-602s1c1
Sequence:CCGGCCATCATCTTGATTGGTTGTTCTCGAGAACAACCAATCAAGATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022032.1-372s1c1
Sequence:CCGGTGGCTTTATCATCCTGTGCATCTCGAGATGCACAGGATGATAAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022032.1-599s1c1
Sequence:CCGGCCACCATCATCTTGATTGGTTCTCGAGAACCAATCAAGATGATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022032.1-1104s1c1
Sequence:CCGGCGTGACCAAATATCCTGAAATCTCGAGATTTCAGGATATTTGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022032.1-538s1c1
Sequence:CCGGCTTCACGATAACCCTGCTGTTCTCGAGAACAGCAGGGTTATCGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022032.4-392s21c1
Sequence:CCGGCTGCTTCATTCTCTCGTTCTTCTCGAGAAGAACGAGAGAATGAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022032.4-977s21c1
Sequence:CCGGGAAACTTGATAAGGTAGAAATCTCGAGATTTCTACCTTATCAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022032
VALIDATED
PERP MISSION shRNA Lentiviral Transduction Particles
PERP, TP53 apoptosis effector
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022032.1-602s1c1
Sequence:CCGGCCATCATCTTGATTGGTTGTTCTCGAGAACAACCAATCAAGATGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022032.1-372s1c1
Sequence:CCGGTGGCTTTATCATCCTGTGCATCTCGAGATGCACAGGATGATAAAGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022032.1-599s1c1
Sequence:CCGGCCACCATCATCTTGATTGGTTCTCGAGAACCAATCAAGATGATGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022032.1-1104s1c1
Sequence:CCGGCGTGACCAAATATCCTGAAATCTCGAGATTTCAGGATATTTGGTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022032.1-538s1c1
Sequence:CCGGCTTCACGATAACCCTGCTGTTCTCGAGAACAGCAGGGTTATCGTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022032.4-392s21c1
Sequence:CCGGCTGCTTCATTCTCTCGTTCTTCTCGAGAAGAACGAGAGAATGAAGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022032.4-977s21c1
Sequence:CCGGGAAACTTGATAAGGTAGAAATCTCGAGATTTCTACCTTATCAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)