EMAIL THIS PAGE TO A FRIEND

PEX11G

peroxisomal biogenesis factor 11 gamma

46 Gene Product Result for
UniProtKB ID: Q96HA9, Q8NDM0
Gene ID:
Human(92960) Summary: The protein encoded by this gene is a member of the PEX11 family. This family is reported to regulate the number and size of peroxisomes in evolutionarily distant organisms. The protein encoded by this gene may induce clustering of peroxisomes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Mouse(69129) peroxisomal biogenesis factor 11 gamma
Rat(288369) peroxisomal biogenesis factor 11 gamma
Zebrafish(563203) peroxisomal biogenesis factor 11 gamma
domestic cat(101098442) peroxisomal biogenesis factor 11 gamma
dog(484992) peroxisomal biogenesis factor 11 gamma
chicken(420131) peroxisomal biogenesis factor 11 gamma
cow(506518) peroxisomal biogenesis factor 11 gamma
sheep(101122599) peroxisomal biogenesis factor 11 gamma
naked mole-rat(101723334) peroxisomal biogenesis factor 11 gamma
domestic guinea pig(100713090) peroxisomal biogenesis factor 11 gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080662 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159941 MISSION® esiRNA esiRNA human PEX11G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080662 Rosetta Predictions human pricing
NM_001105902 Rosetta Predictions rat pricing
NM_026951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052508 predicted 277
2 SASI_Hs01_00052509 predicted 262
3 SASI_Hs01_00052510 predicted 209
4 SASI_Hs01_00052511 predicted 214
5 SASI_Hs01_00052512 predicted 220
6 SASI_Hs01_00052514 predicted 523
7 SASI_Hs01_00052515 predicted 554
8 SASI_Hs01_00052516 predicted 210
9 SASI_Hs02_00362423 predicted 669
10 SASI_Hs02_00362424 predicted 251
11 SASI_Hs01_00052513 predicted 294
12 SASI_Hs01_00052517 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213662 predicted 249
2 SASI_Rn02_00213663 predicted 587
3 SASI_Rn02_00213664 predicted 309
4 SASI_Rn02_00213665 predicted 813
5 SASI_Rn02_00213666 predicted 625
6 SASI_Rn02_00213667 predicted 571
7 SASI_Rn02_00213668 predicted 570
8 SASI_Rn02_00213669 predicted 341
9 SASI_Rn02_00213670 predicted 345
10 SASI_Rn02_00213671 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159965 predicted 761
2 SASI_Mm01_00159966 predicted 314
3 SASI_Mm01_00159967 predicted 311
4 SASI_Mm01_00159968 predicted 591
5 SASI_Mm01_00159969 predicted 238
6 SASI_Mm01_00159970 predicted 448
7 SASI_Mm01_00159971 predicted 307
8 SASI_Mm01_00159972 predicted 374
9 SASI_Mm01_00159974 predicted 242
10 SASI_Mm02_00331270 predicted 370
11 SASI_Mm01_00159973 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026951
PEX11G MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 11 gamma
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026951.2-877s21c1
Sequence:CCGGGGGCTGAAATGAGATCTTCTCCTCGAGGAGAAGATCTCATTTCAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026951.2-453s21c1
Sequence:CCGGTGGACAATGCTGAAGCTTAGACTCGAGTCTAAGCTTCAGCATTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026951.2-171s21c1
Sequence:CCGGGTGTCAGCCCAGTTCAATCATCTCGAGATGATTGAACTGGGCTGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026951.1-779s1c1
Sequence:CCGGGTGCTCAACAGGACTCAGATTCTCGAGAATCTGAGTCCTGTTGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-231s1c1
Sequence:CCGGGTTTGTCTACACTAAGCAGTACTCGAGTACTGCTTAGTGTAGACAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-412s1c1
Sequence:CCGGCTCTGGACTCTCTCTCTACTTCTCGAGAAGTAGAGAGAGAGTCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-544s1c1
Sequence:CCGGGCAAGGATATGCTCAGAGGTTCTCGAGAACCTCTGAGCATATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-301s1c1
Sequence:CCGGCTGAGTAATGTGACTGACCAACTCGAGTTGGTCAGTCACATTACTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026951
PEX11G MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 11 gamma
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026951.2-877s21c1
Sequence:CCGGGGGCTGAAATGAGATCTTCTCCTCGAGGAGAAGATCTCATTTCAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026951.2-453s21c1
Sequence:CCGGTGGACAATGCTGAAGCTTAGACTCGAGTCTAAGCTTCAGCATTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026951.2-171s21c1
Sequence:CCGGGTGTCAGCCCAGTTCAATCATCTCGAGATGATTGAACTGGGCTGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026951.1-779s1c1
Sequence:CCGGGTGCTCAACAGGACTCAGATTCTCGAGAATCTGAGTCCTGTTGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-231s1c1
Sequence:CCGGGTTTGTCTACACTAAGCAGTACTCGAGTACTGCTTAGTGTAGACAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-412s1c1
Sequence:CCGGCTCTGGACTCTCTCTCTACTTCTCGAGAAGTAGAGAGAGAGTCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-544s1c1
Sequence:CCGGGCAAGGATATGCTCAGAGGTTCTCGAGAACCTCTGAGCATATCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-301s1c1
Sequence:CCGGCTGAGTAATGTGACTGACCAACTCGAGTTGGTCAGTCACATTACTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026951
PEX11G MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 11 gamma
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026951.2-877s21c1
Sequence:CCGGGGGCTGAAATGAGATCTTCTCCTCGAGGAGAAGATCTCATTTCAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026951.2-453s21c1
Sequence:CCGGTGGACAATGCTGAAGCTTAGACTCGAGTCTAAGCTTCAGCATTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026951.2-171s21c1
Sequence:CCGGGTGTCAGCCCAGTTCAATCATCTCGAGATGATTGAACTGGGCTGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026951.1-779s1c1
Sequence:CCGGGTGCTCAACAGGACTCAGATTCTCGAGAATCTGAGTCCTGTTGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-231s1c1
Sequence:CCGGGTTTGTCTACACTAAGCAGTACTCGAGTACTGCTTAGTGTAGACAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-412s1c1
Sequence:CCGGCTCTGGACTCTCTCTCTACTTCTCGAGAAGTAGAGAGAGAGTCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-544s1c1
Sequence:CCGGGCAAGGATATGCTCAGAGGTTCTCGAGAACCTCTGAGCATATCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026951.1-301s1c1
Sequence:CCGGCTGAGTAATGTGACTGACCAACTCGAGTTGGTCAGTCACATTACTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080662
PEX11G MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 11 gamma
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-100s21c1
Sequence:CCGGGTTGGTGGAGTTCTGGTTGAACTCGAGTTCAACCAGAACTCCACCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-188s21c1
Sequence:CCGGGGACCATCTTGCGACTCTTTGCTCGAGCAAAGAGTCGCAAGATGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080662.2-967s21c1
Sequence:CCGGGCTGGCGTCTTGTATCCAAATCTCGAGATTTGGATACAAGACGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-658s21c1
Sequence:CCGGATGGGCACCATCTCCTCAATCCTCGAGGATTGAGGAGATGGTGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-223s21c1
Sequence:CCGGTTTGTCTACACTAAGCAATATCTCGAGATATTGCTTAGTGTAGACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183085    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080662.2-972s1c1
Sequence:CCGGCGTCTTGTATCCAAATCAAGACTCGAGTCTTGATTTGGATACAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080662
PEX11G MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 11 gamma
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-100s21c1
Sequence:CCGGGTTGGTGGAGTTCTGGTTGAACTCGAGTTCAACCAGAACTCCACCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-188s21c1
Sequence:CCGGGGACCATCTTGCGACTCTTTGCTCGAGCAAAGAGTCGCAAGATGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080662.2-967s21c1
Sequence:CCGGGCTGGCGTCTTGTATCCAAATCTCGAGATTTGGATACAAGACGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-658s21c1
Sequence:CCGGATGGGCACCATCTCCTCAATCCTCGAGGATTGAGGAGATGGTGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-223s21c1
Sequence:CCGGTTTGTCTACACTAAGCAATATCTCGAGATATTGCTTAGTGTAGACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183085    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080662.2-972s1c1
Sequence:CCGGCGTCTTGTATCCAAATCAAGACTCGAGTCTTGATTTGGATACAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080662
PEX11G MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 11 gamma
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-100s21c1
Sequence:CCGGGTTGGTGGAGTTCTGGTTGAACTCGAGTTCAACCAGAACTCCACCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-188s21c1
Sequence:CCGGGGACCATCTTGCGACTCTTTGCTCGAGCAAAGAGTCGCAAGATGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080662.2-967s21c1
Sequence:CCGGGCTGGCGTCTTGTATCCAAATCTCGAGATTTGGATACAAGACGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-658s21c1
Sequence:CCGGATGGGCACCATCTCCTCAATCCTCGAGGATTGAGGAGATGGTGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080662.2-223s21c1
Sequence:CCGGTTTGTCTACACTAAGCAATATCTCGAGATATTGCTTAGTGTAGACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183085    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080662.2-972s1c1
Sequence:CCGGCGTCTTGTATCCAAATCAAGACTCGAGTCTTGATTTGGATACAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)