EMAIL THIS PAGE TO A FRIEND

PEX19

peroxisomal biogenesis factor 19

218 Gene Product Result for
Synonyms: D1S2223E HK33 PBD12A PMP1 PMPI PXF PXMP1
UniProtKB ID: P40855, D3DVE7, Q5QNY4, Q8NI97
Gene ID:
Human(5824) Summary: This gene is necessary for early peroxisomal biogenesis. It acts both as a cytosolic chaperone and as an import receptor for peroxisomal membrane proteins (PMPs). Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. These disorders have at least 14 complementation groups, with more than one phenotype being observed for some complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of Zellweger syndrome (ZWS), as well as peroxisome biogenesis disorder complementation group 14 (PBD-CG14), which is also known as PBD-CGJ. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Mouse(19298) peroxisomal biogenesis factor 19
Rat(289233) peroxisomal biogenesis factor 19
domestic guinea pig(100730897) peroxisomal biogenesis factor 19
naked mole-rat(101718390) peroxisomal biogenesis factor 19
cow(521522) peroxisomal biogenesis factor 19
sheep(101119432) peroxisomal biogenesis factor 19
fruit fly(34630) Peroxin 19
dog(478972) peroxisomal biogenesis factor 19
Zebrafish(324778) peroxisomal biogenesis factor 19
domestic cat(101094898) peroxisomal biogenesis factor 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100530 Anti-PEX19 (197-210) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100529 Anti-PEX19 (46-57) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW22267F Anti-PEX19 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
SAB1401323 Anti-PEX19 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4502551 Anti-PEX19 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA044837 Anti-PEX19 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
HPA051966 Anti-PEX19 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1402331 Monoclonal Anti-PEX19 antibody produced in mouse clone 2E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2702188 Monoclonal Anti-PEX19 antibody produced in mouse clone GT554, affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB2702209 Monoclonal Anti-PEX19 antibody produced in mouse clone GT533, affinity isolated antibody rat, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002857 Rosetta Predictions human pricing
NM_001107375 Rosetta Predictions rat pricing
NM_001134777 Rosetta Predictions rat pricing
NM_023041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208335 predicted 1135
2 SASI_Hs01_00208336 predicted 608
3 SASI_Hs01_00208337 predicted 625
4 SASI_Hs01_00208338 predicted 550
5 SASI_Hs01_00208340 predicted 785
6 SASI_Hs02_00334611 predicted 238
7 SASI_Hs01_00208341 predicted 538
8 SASI_Hs01_00208342 predicted 792
9 SASI_Hs02_00334612 predicted 1079
10 SASI_Hs02_00334613 predicted 1249
11 SASI_Hs01_00208333 predicted 366
12 SASI_Hs01_00208334 predicted 585
13 SASI_Hs01_00208339 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228205 predicted 462
2 SASI_Rn02_00228206 predicted 557
3 SASI_Rn02_00228207 predicted 555
4 SASI_Rn02_00228208 predicted 275
5 SASI_Rn02_00228209 predicted 440
6 SASI_Rn02_00228210 predicted 289
7 SASI_Rn02_00228211 predicted 272
8 SASI_Rn02_00228212 predicted 373
9 SASI_Rn02_00228213 predicted 375
10 SASI_Rn02_00228214 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258474 predicted 466
2 SASI_Rn02_00258475 predicted 560
3 SASI_Rn02_00258476 predicted 549
4 SASI_Rn02_00258477 predicted 274
5 SASI_Rn02_00258478 predicted 444
6 SASI_Rn02_00258479 predicted 290
7 SASI_Rn02_00258480 predicted 276
8 SASI_Rn02_00258481 predicted 375
9 SASI_Rn02_00258482 predicted 380
10 SASI_Rn02_00258483 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130562 predicted 966
2 SASI_Mm01_00130563 predicted 885
3 SASI_Mm01_00130564 predicted 811
4 SASI_Mm01_00130565 predicted 398
5 SASI_Mm01_00130567 predicted 1100
6 SASI_Mm01_00130568 predicted 354
7 SASI_Mm01_00130569 predicted 1107
8 SASI_Mm01_00130570 predicted 717
9 SASI_Mm02_00326730 predicted 874
10 SASI_Mm02_00326731 predicted 1080
11 SASI_Mm01_00130561 predicted 546
12 SASI_Mm01_00130566 predicted 751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002857
VALIDATED
PEX19 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-762s21c1
Sequence:CCGGGAGATGGTGCTGGATCTTATGCTCGAGCATAAGATCCAGCACCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-534s21c1
Sequence:CCGGCCCATCATGCAGAGTATTATGCTCGAGCATAATACTCTGCATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-854s21c1
Sequence:CCGGCCTGGATGCCCTCAATCTTTCCTCGAGGAAAGATTGAGGGCATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-90s21c1
Sequence:CCGGGCTCTTGATGATTTCGATAAACTCGAGTTTATCGAAATCATCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002857.2-90s1c1
Sequence:CCGGGCTCTTGATGATTTCGATAAACTCGAGTTTATCGAAATCATCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002857.2-1832s1c1
Sequence:CCGGCCCAGATACATTCTGGCTTATCTCGAGATAAGCCAGAATGTATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002857.2-615s1c1
Sequence:CCGGCCAGAATGGTTGCAGAGTCATCTCGAGATGACTCTGCAACCATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002857.2-774s1c1
Sequence:CCGGGATCTTATGCAGCAGCTACAACTCGAGTTGTAGCTGCTGCATAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002857.2-88s1c1
Sequence:CCGGGTGCTCTTGATGATTTCGATACTCGAGTATCGAAATCATCAAGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002857.2-2837s21c1
Sequence:CCGGTAGATGCCCTAGTCCACTTTACTCGAGTAAAGTGGACTAGGGCATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002857
VALIDATED
PEX19 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-762s21c1
Sequence:CCGGGAGATGGTGCTGGATCTTATGCTCGAGCATAAGATCCAGCACCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-534s21c1
Sequence:CCGGCCCATCATGCAGAGTATTATGCTCGAGCATAATACTCTGCATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-854s21c1
Sequence:CCGGCCTGGATGCCCTCAATCTTTCCTCGAGGAAAGATTGAGGGCATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-90s21c1
Sequence:CCGGGCTCTTGATGATTTCGATAAACTCGAGTTTATCGAAATCATCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002857.2-90s1c1
Sequence:CCGGGCTCTTGATGATTTCGATAAACTCGAGTTTATCGAAATCATCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002857.2-1832s1c1
Sequence:CCGGCCCAGATACATTCTGGCTTATCTCGAGATAAGCCAGAATGTATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002857.2-615s1c1
Sequence:CCGGCCAGAATGGTTGCAGAGTCATCTCGAGATGACTCTGCAACCATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002857.2-774s1c1
Sequence:CCGGGATCTTATGCAGCAGCTACAACTCGAGTTGTAGCTGCTGCATAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002857.2-88s1c1
Sequence:CCGGGTGCTCTTGATGATTTCGATACTCGAGTATCGAAATCATCAAGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002857.2-2837s21c1
Sequence:CCGGTAGATGCCCTAGTCCACTTTACTCGAGTAAAGTGGACTAGGGCATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002857
VALIDATED
PEX19 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-762s21c1
Sequence:CCGGGAGATGGTGCTGGATCTTATGCTCGAGCATAAGATCCAGCACCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-534s21c1
Sequence:CCGGCCCATCATGCAGAGTATTATGCTCGAGCATAATACTCTGCATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-854s21c1
Sequence:CCGGCCTGGATGCCCTCAATCTTTCCTCGAGGAAAGATTGAGGGCATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002857.2-90s21c1
Sequence:CCGGGCTCTTGATGATTTCGATAAACTCGAGTTTATCGAAATCATCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002857.2-90s1c1
Sequence:CCGGGCTCTTGATGATTTCGATAAACTCGAGTTTATCGAAATCATCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002857.2-1832s1c1
Sequence:CCGGCCCAGATACATTCTGGCTTATCTCGAGATAAGCCAGAATGTATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002857.2-615s1c1
Sequence:CCGGCCAGAATGGTTGCAGAGTCATCTCGAGATGACTCTGCAACCATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002857.2-774s1c1
Sequence:CCGGGATCTTATGCAGCAGCTACAACTCGAGTTGTAGCTGCTGCATAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002857.2-88s1c1
Sequence:CCGGGTGCTCTTGATGATTTCGATACTCGAGTATCGAAATCATCAAGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002857.2-2837s21c1
Sequence:CCGGTAGATGCCCTAGTCCACTTTACTCGAGTAAAGTGGACTAGGGCATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023041
PEX19 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-743s1c1
Sequence:CCGGGCTCGCTTTGAGGCCATGCTACTCGAGTAGCATGGCCTCAAAGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023041.2-1101s1c1
Sequence:CCGGGCTGTTAGAAACAGGCCAATTCTCGAGAATTGGCCTGTTTCTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-553s1c1
Sequence:CCGGCCTGTCTAAGGATGTGCTGTACTCGAGTACAGCACATCCTTAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-362s1c1
Sequence:CCGGGCAAGTTCTCAGCAAGAGTTTCTCGAGAAACTCTTGCTGAGAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-80s1c1
Sequence:CCGGGCTCTTGATGATTTCGACGAACTCGAGTTCGTCGAAATCATCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023041
PEX19 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-743s1c1
Sequence:CCGGGCTCGCTTTGAGGCCATGCTACTCGAGTAGCATGGCCTCAAAGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023041.2-1101s1c1
Sequence:CCGGGCTGTTAGAAACAGGCCAATTCTCGAGAATTGGCCTGTTTCTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-553s1c1
Sequence:CCGGCCTGTCTAAGGATGTGCTGTACTCGAGTACAGCACATCCTTAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-362s1c1
Sequence:CCGGGCAAGTTCTCAGCAAGAGTTTCTCGAGAAACTCTTGCTGAGAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-80s1c1
Sequence:CCGGGCTCTTGATGATTTCGACGAACTCGAGTTCGTCGAAATCATCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023041
PEX19 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-743s1c1
Sequence:CCGGGCTCGCTTTGAGGCCATGCTACTCGAGTAGCATGGCCTCAAAGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023041.2-1101s1c1
Sequence:CCGGGCTGTTAGAAACAGGCCAATTCTCGAGAATTGGCCTGTTTCTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-553s1c1
Sequence:CCGGCCTGTCTAAGGATGTGCTGTACTCGAGTACAGCACATCCTTAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-362s1c1
Sequence:CCGGGCAAGTTCTCAGCAAGAGTTTCTCGAGAAACTCTTGCTGAGAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023041.2-80s1c1
Sequence:CCGGGCTCTTGATGATTTCGACGAACTCGAGTTCGTCGAAATCATCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)