EMAIL THIS PAGE TO A FRIEND

PEX26

peroxisomal biogenesis factor 26

57 Gene Product Result for
Synonyms: PBD7A PBD7B PEX26M1T Pex26pM1T
Gene ID:
Human(55670) Summary: This gene belongs to the peroxin-26 gene family. It is probably required for protein import into peroxisomes. It anchors PEX1 and PEX6 to peroxisome membranes, possibly to form heteromeric AAA ATPase complexes required for the import of proteins into peroxisomes. Defects in this gene are the cause of peroxisome biogenesis disorder complementation group 8 (PBD-CG8). PBD refers to a group of peroxisomal disorders arising from a failure of protein import into the peroxisomal membrane or matrix. The PBD group is comprised of four disorders: Zellweger syndrome (ZWS), neonatal adrenoleukodystrophy (NALD), infantile Refsum disease (IRD), and classical rhizomelic chondrodysplasia punctata (RCDP). Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2010]
Mouse(74043) peroxisomal biogenesis factor 26
Rat(297570) peroxisomal biogenesis factor 26
Zebrafish(334644) peroxisomal biogenesis factor 26
domestic cat(101081310) peroxisomal biogenesis factor 26
dog(477743) peroxisomal biogenesis factor 26
chicken(418165) peroxisomal biogenesis factor 26
domestic guinea pig(100726514) peroxisomal biogenesis factor 26
naked mole-rat(101709561) peroxisomal biogenesis factor 26
cow(537878) peroxisomal biogenesis factor 26
sheep(101118352) peroxisomal biogenesis factor 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017929 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU027191 MISSION® esiRNA esiRNA targeting mouse Pex26 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127649 Rosetta Predictions human pricing
NM_017929 Rosetta Predictions human pricing
NM_001106618 Rosetta Predictions rat pricing
NM_028730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329984 predicted 1543
2 SASI_Hs02_00329985 predicted 1271
3 SASI_Hs02_00329986 predicted 771
4 SASI_Hs02_00329987 predicted 1239
5 SASI_Hs02_00329988 predicted 1456
6 SASI_Hs02_00329989 predicted 1239
7 SASI_Hs02_00329990 predicted 1311
8 SASI_Hs02_00329991 predicted 1124
9 SASI_Hs02_00329992 predicted 1018
10 SASI_Hs02_00329993 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350929 predicted 1298
2 SASI_Hs01_00199310 predicted 1020
3 SASI_Hs01_00199311 predicted 527
4 SASI_Hs01_00199312 predicted 992
5 SASI_Hs01_00199313 predicted 1216
6 SASI_Hs02_00350930 predicted 983
7 SASI_Hs01_00199314 predicted 1058
8 SASI_Hs02_00350931 predicted 875
9 SASI_Hs01_00199318 predicted 766
10 SASI_Hs01_00199319 predicted 1226
11 SASI_Hs01_00199315 predicted 768
12 SASI_Hs01_00199316 predicted 869
13 SASI_Hs01_00199317 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220718 predicted 1503
2 SASI_Rn02_00220719 predicted 1394
3 SASI_Rn02_00220720 predicted 1088
4 SASI_Rn02_00220721 predicted 1587
5 SASI_Rn02_00220722 predicted 1673
6 SASI_Rn02_00220723 predicted 1075
7 SASI_Rn02_00220724 predicted 975
8 SASI_Rn02_00220725 predicted 1015
9 SASI_Rn02_00220726 predicted 615
10 SASI_Rn02_00220727 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138450 predicted 1379
2 SASI_Mm01_00138451 predicted 1449
3 SASI_Mm01_00138452 predicted 1256
4 SASI_Mm01_00138453 predicted 1370
5 SASI_Mm01_00138454 predicted 1068
6 SASI_Mm01_00138455 predicted 1063
7 SASI_Mm02_00334293 predicted 1409
8 SASI_Mm01_00138456 predicted 735
9 SASI_Mm01_00138457 predicted 1526
10 SASI_Mm01_00138458 predicted 1668
11 SASI_Mm01_00138459 predicted 1664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017929
VALIDATED
PEX26 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 26
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017929.4-1074s21c1
Sequence:CCGGTGGATCCGGAAGGCTGCATTTCTCGAGAAATGCAGCCTTCCGGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017929.2-518s1c1
Sequence:CCGGCTGGGTCCTTCAGTATTACCACTCGAGTGGTAATACTGAAGGACCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017929.2-489s1c1
Sequence:CCGGGAAATGGATCGGTGGCAAGAACTCGAGTTCTTGCCACCGATCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017929.2-528s1c1
Sequence:CCGGCAGTATTACCAGGTCCCTGAACTCGAGTTCAGGGACCTGGTAATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017929.4-786s21c1
Sequence:CCGGCTGGATGTACTTCAGGCCATTCTCGAGAATGGCCTGAAGTACATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017929.4-1458s21c1
Sequence:CCGGCTTCAGGTCAGGATGTTAATGCTCGAGCATTAACATCCTGACCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017929.4-996s21c1
Sequence:CCGGTGTCTCCTGGTGGTGAGATTTCTCGAGAAATCTCACCACCAGGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017929.4-676s21c1
Sequence:CCGGATGGAGCCTTGGCAGAATTTCCTCGAGGAAATTCTGCCAAGGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017929.2-783s1c1
Sequence:CCGGCTGGATGTACTTCAGGCCATTCTCGAGAATGGCCTGAAGTACATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017929
VALIDATED
PEX26 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 26
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017929.4-1074s21c1
Sequence:CCGGTGGATCCGGAAGGCTGCATTTCTCGAGAAATGCAGCCTTCCGGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017929.2-518s1c1
Sequence:CCGGCTGGGTCCTTCAGTATTACCACTCGAGTGGTAATACTGAAGGACCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017929.2-489s1c1
Sequence:CCGGGAAATGGATCGGTGGCAAGAACTCGAGTTCTTGCCACCGATCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017929.2-528s1c1
Sequence:CCGGCAGTATTACCAGGTCCCTGAACTCGAGTTCAGGGACCTGGTAATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017929.4-786s21c1
Sequence:CCGGCTGGATGTACTTCAGGCCATTCTCGAGAATGGCCTGAAGTACATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017929.4-1458s21c1
Sequence:CCGGCTTCAGGTCAGGATGTTAATGCTCGAGCATTAACATCCTGACCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017929.4-996s21c1
Sequence:CCGGTGTCTCCTGGTGGTGAGATTTCTCGAGAAATCTCACCACCAGGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017929.4-676s21c1
Sequence:CCGGATGGAGCCTTGGCAGAATTTCCTCGAGGAAATTCTGCCAAGGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017929.2-783s1c1
Sequence:CCGGCTGGATGTACTTCAGGCCATTCTCGAGAATGGCCTGAAGTACATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017929
VALIDATED
PEX26 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 26
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017929.4-1074s21c1
Sequence:CCGGTGGATCCGGAAGGCTGCATTTCTCGAGAAATGCAGCCTTCCGGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017929.2-518s1c1
Sequence:CCGGCTGGGTCCTTCAGTATTACCACTCGAGTGGTAATACTGAAGGACCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017929.2-489s1c1
Sequence:CCGGGAAATGGATCGGTGGCAAGAACTCGAGTTCTTGCCACCGATCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017929.2-528s1c1
Sequence:CCGGCAGTATTACCAGGTCCCTGAACTCGAGTTCAGGGACCTGGTAATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017929.4-786s21c1
Sequence:CCGGCTGGATGTACTTCAGGCCATTCTCGAGAATGGCCTGAAGTACATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017929.4-1458s21c1
Sequence:CCGGCTTCAGGTCAGGATGTTAATGCTCGAGCATTAACATCCTGACCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017929.4-996s21c1
Sequence:CCGGTGTCTCCTGGTGGTGAGATTTCTCGAGAAATCTCACCACCAGGAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017929.4-676s21c1
Sequence:CCGGATGGAGCCTTGGCAGAATTTCCTCGAGGAAATTCTGCCAAGGCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017929.2-783s1c1
Sequence:CCGGCTGGATGTACTTCAGGCCATTCTCGAGAATGGCCTGAAGTACATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028730
VALIDATED
PEX26 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 26
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028730.5-813s21c1
Sequence:CCGGGCACCATTGTGGAGGTGAAATCTCGAGATTTCACCTCCACAATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028730.5-3455s21c1
Sequence:CCGGAGGGCCTCTTCTACGAGTAATCTCGAGATTACTCGTAGAAGAGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028730.2-1541s1c1
Sequence:CCGGCCTCTTACACTCCACATCTATCTCGAGATAGATGTGGAGTGTAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028730.5-1377s21c1
Sequence:CCGGTGATCCTCTGCCTCTTGATTCCTCGAGGAATCAAGAGGCAGAGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028730.5-1035s21c1
Sequence:CCGGACCAGGGCCTTCCTGATTATGCTCGAGCATAATCAGGAAGGCCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028730.5-853s21c1
Sequence:CCGGGATCCAGGCTCTGGCAGAAATCTCGAGATTTCTGCCAGAGCCTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028730.5-1388s1c1
Sequence:CCGGCTCTTGATTCTACGGTTTGACCTCGAGGTCAAACCGTAGAATCAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028730.2-3002s1c1
Sequence:CCGGGCCCTAGAAGAAACTCCTTAACTCGAGTTAAGGAGTTTCTTCTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028730
VALIDATED
PEX26 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 26
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028730.5-813s21c1
Sequence:CCGGGCACCATTGTGGAGGTGAAATCTCGAGATTTCACCTCCACAATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028730.5-3455s21c1
Sequence:CCGGAGGGCCTCTTCTACGAGTAATCTCGAGATTACTCGTAGAAGAGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028730.2-1541s1c1
Sequence:CCGGCCTCTTACACTCCACATCTATCTCGAGATAGATGTGGAGTGTAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028730.5-1377s21c1
Sequence:CCGGTGATCCTCTGCCTCTTGATTCCTCGAGGAATCAAGAGGCAGAGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028730.5-1035s21c1
Sequence:CCGGACCAGGGCCTTCCTGATTATGCTCGAGCATAATCAGGAAGGCCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028730.5-853s21c1
Sequence:CCGGGATCCAGGCTCTGGCAGAAATCTCGAGATTTCTGCCAGAGCCTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028730.5-1388s1c1
Sequence:CCGGCTCTTGATTCTACGGTTTGACCTCGAGGTCAAACCGTAGAATCAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028730.2-3002s1c1
Sequence:CCGGGCCCTAGAAGAAACTCCTTAACTCGAGTTAAGGAGTTTCTTCTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028730
VALIDATED
PEX26 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 26
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028730.5-813s21c1
Sequence:CCGGGCACCATTGTGGAGGTGAAATCTCGAGATTTCACCTCCACAATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028730.5-3455s21c1
Sequence:CCGGAGGGCCTCTTCTACGAGTAATCTCGAGATTACTCGTAGAAGAGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028730.2-1541s1c1
Sequence:CCGGCCTCTTACACTCCACATCTATCTCGAGATAGATGTGGAGTGTAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028730.5-1377s21c1
Sequence:CCGGTGATCCTCTGCCTCTTGATTCCTCGAGGAATCAAGAGGCAGAGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028730.5-1035s21c1
Sequence:CCGGACCAGGGCCTTCCTGATTATGCTCGAGCATAATCAGGAAGGCCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028730.5-853s21c1
Sequence:CCGGGATCCAGGCTCTGGCAGAAATCTCGAGATTTCTGCCAGAGCCTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028730.5-1388s1c1
Sequence:CCGGCTCTTGATTCTACGGTTTGACCTCGAGGTCAAACCGTAGAATCAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028730.2-3002s1c1
Sequence:CCGGGCCCTAGAAGAAACTCCTTAACTCGAGTTAAGGAGTTTCTTCTAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)