EMAIL THIS PAGE TO A FRIEND

PEX5

peroxisomal biogenesis factor 5

188 Gene Product Result for
Synonyms: PBD2A PBD2B PTS1-BP PTS1R PXR1
Gene ID:
Human(5830) Summary: The product of this gene binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal (SKL-type) and plays an essential role in peroxisomal protein import. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of neonatal adrenoleukodystrophy (NALD), a cause of Zellweger syndrome (ZWS) as well as may be a cause of infantile Refsum disease (IRD). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
Mouse(19305) peroxisomal biogenesis factor 5
Rat(312703) peroxisomal biogenesis factor 5
fruit fly(31141) Peroxin 5
Horse(100053174) peroxisomal biogenesis factor 5
domestic cat(101089871) peroxisomal biogenesis factor 5
dog(486710) peroxisomal biogenesis factor 5
chicken(418299) peroxisomal biogenesis factor 5
Zebrafish(394131) peroxisomal biogenesis factor 5
domestic guinea pig(100135597) peroxisomal biogenesis factor 5
Domestic Rabbit(100343561) peroxisomal biogenesis factor 5
naked mole-rat(101700051) peroxisomal biogenesis factor 5
cow(514832) peroxisomal biogenesis factor 5
sheep(101105736) peroxisomal biogenesis factor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000319 Rosetta Predictions human pricing
XM_001062081 Rosetta Predictions rat pricing
XM_232343 Rosetta Predictions rat pricing
NM_008995 Rosetta Predictions mouse pricing
NM_175933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087609 predicted 1675
2 SASI_Hs01_00087610 predicted 812
3 SASI_Hs01_00087611 predicted 1604
4 SASI_Hs01_00087612 predicted 518
5 SASI_Hs01_00087613 predicted 753
6 SASI_Hs01_00087614 predicted 1158
7 SASI_Hs01_00087615 predicted 1570
8 SASI_Hs01_00087616 predicted 313
9 SASI_Hs02_00302328 predicted 629
10 SASI_Hs01_00087617 predicted 1114
11 SASI_Hs01_00087618 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302337 predicted 2252
2 SASI_Rn02_00302338 predicted 2099
3 SASI_Rn02_00302339 predicted 1491
4 SASI_Rn02_00302340 predicted 594
5 SASI_Rn02_00302341 predicted 1471
6 SASI_Rn02_00302342 predicted 1906
7 SASI_Rn02_00302343 predicted 1101
8 SASI_Rn02_00302344 predicted 1507
9 SASI_Rn02_00302345 predicted 869
10 SASI_Rn02_00302346 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387100 predicted 2245
2 SASI_Rn02_00387101 predicted 2107
3 SASI_Rn02_00387102 predicted 1489
4 SASI_Rn02_00387103 predicted 600
5 SASI_Rn02_00387104 predicted 1474
6 SASI_Rn02_00387105 predicted 1900
7 SASI_Rn02_00387106 predicted 1101
8 SASI_Rn02_00387107 predicted 1505
9 SASI_Rn02_00387108 predicted 868
10 SASI_Rn02_00387109 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020537 predicted 349
2 SASI_Mm01_00020538 predicted 1026
3 SASI_Mm02_00315097 predicted 1898
4 SASI_Mm01_00020539 predicted 401
5 SASI_Mm02_00315098 predicted 1276
6 SASI_Mm01_00020540 predicted 1730
7 SASI_Mm02_00315099 predicted 459
8 SASI_Mm01_00020542 predicted 333
9 SASI_Mm01_00020543 predicted 494
10 SASI_Mm02_00315100 predicted 1291
11 SASI_Mm01_00020536 predicted 601
12 SASI_Mm01_00020541 predicted 863
13 SASI_Mm01_00020544 predicted 1650
14 SASI_Mm01_00020545 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103452 predicted 385
2 SASI_Mm01_00103453 predicted 958
3 SASI_Mm01_00103454 predicted 1822
4 SASI_Mm01_00103455 predicted 439
5 SASI_Mm02_00346684 predicted 1199
6 SASI_Mm01_00103456 predicted 1655
7 SASI_Mm02_00346685 predicted 498
8 SASI_Mm02_00346686 predicted 369
9 SASI_Mm01_00103458 predicted 536
10 SASI_Mm02_00346687 predicted 1216
11 SASI_Mm01_00103457 predicted 843
12 SASI_Mm01_00103459 predicted 694
13 SASI_Mm01_00103460 predicted 1632
14 SASI_Mm01_00103461 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008995
VALIDATED
PEX5 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008995.1-157s1c1
Sequence:CCGGCCTTTGGGAGTAGGAACTGAACTCGAGTTCAGTTCCTACTCCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008995.1-1384s1c1
Sequence:CCGGCTGTTGTCTGACTCCCTGTTTCTCGAGAAACAGGGAGTCAGACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008995.1-770s1c1
Sequence:CCGGCCTGGGTTGATCAGTTTACAACTCGAGTTGTAAACTGATCAACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008995.1-1447s1c1
Sequence:CCGGCCTACATCCATTGACCCTGATCTCGAGATCAGGGTCAATGGATGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008995.1-550s1c1
Sequence:CCGGCGATGGTACGATGAATATCATCTCGAGATGATATTCATCGTACCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008995.2-2312s21c1
Sequence:CCGGCTGATAGGGTCTGCCACATTTCTCGAGAAATGTGGCAGACCCTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-2149s21c1
Sequence:CCGGGTGTCTTAGGTCCTACTTAATCTCGAGATTAAGTAGGACCTAAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-845s21c1
Sequence:CCGGCCTGGGTTGATCAGTTTACAACTCGAGTTGTAAACTGATCAACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-921s21c1
Sequence:CCGGTATAGAGTCTGATGTCGATTTCTCGAGAAATCGACATCAGACTCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-621s21c1
Sequence:CCGGTGATCGATGGTACGATGAATACTCGAGTATTCATCGTACCATCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008995
VALIDATED
PEX5 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008995.1-157s1c1
Sequence:CCGGCCTTTGGGAGTAGGAACTGAACTCGAGTTCAGTTCCTACTCCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008995.1-1384s1c1
Sequence:CCGGCTGTTGTCTGACTCCCTGTTTCTCGAGAAACAGGGAGTCAGACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008995.1-770s1c1
Sequence:CCGGCCTGGGTTGATCAGTTTACAACTCGAGTTGTAAACTGATCAACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008995.1-1447s1c1
Sequence:CCGGCCTACATCCATTGACCCTGATCTCGAGATCAGGGTCAATGGATGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008995.1-550s1c1
Sequence:CCGGCGATGGTACGATGAATATCATCTCGAGATGATATTCATCGTACCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008995.2-2312s21c1
Sequence:CCGGCTGATAGGGTCTGCCACATTTCTCGAGAAATGTGGCAGACCCTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-2149s21c1
Sequence:CCGGGTGTCTTAGGTCCTACTTAATCTCGAGATTAAGTAGGACCTAAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-845s21c1
Sequence:CCGGCCTGGGTTGATCAGTTTACAACTCGAGTTGTAAACTGATCAACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-921s21c1
Sequence:CCGGTATAGAGTCTGATGTCGATTTCTCGAGAAATCGACATCAGACTCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-621s21c1
Sequence:CCGGTGATCGATGGTACGATGAATACTCGAGTATTCATCGTACCATCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008995
VALIDATED
PEX5 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008995.1-157s1c1
Sequence:CCGGCCTTTGGGAGTAGGAACTGAACTCGAGTTCAGTTCCTACTCCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008995.1-1384s1c1
Sequence:CCGGCTGTTGTCTGACTCCCTGTTTCTCGAGAAACAGGGAGTCAGACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008995.1-770s1c1
Sequence:CCGGCCTGGGTTGATCAGTTTACAACTCGAGTTGTAAACTGATCAACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008995.1-1447s1c1
Sequence:CCGGCCTACATCCATTGACCCTGATCTCGAGATCAGGGTCAATGGATGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008995.1-550s1c1
Sequence:CCGGCGATGGTACGATGAATATCATCTCGAGATGATATTCATCGTACCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008995.2-2312s21c1
Sequence:CCGGCTGATAGGGTCTGCCACATTTCTCGAGAAATGTGGCAGACCCTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-2149s21c1
Sequence:CCGGGTGTCTTAGGTCCTACTTAATCTCGAGATTAAGTAGGACCTAAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-845s21c1
Sequence:CCGGCCTGGGTTGATCAGTTTACAACTCGAGTTGTAAACTGATCAACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-921s21c1
Sequence:CCGGTATAGAGTCTGATGTCGATTTCTCGAGAAATCGACATCAGACTCTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008995.2-621s21c1
Sequence:CCGGTGATCGATGGTACGATGAATACTCGAGTATTCATCGTACCATCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000319
VALIDATED
PEX5 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000319.3-2374s1c1
Sequence:CCGGGCCTCTAATGTCTGTCTGGATCTCGAGATCCAGACAGACATTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-1833s1c1
Sequence:CCGGCCTGCGTTTGGCATTGTCTATCTCGAGATAGACAATGCCAAACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-844s1c1
Sequence:CCGGGCCCTTGATATGGAGTTTGAACTCGAGTTCAAACTCCATATCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-312s1c1
Sequence:CCGGGCAGCAGATTGAGCAGTCAAACTCGAGTTTGACTGCTCAATCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-422s1c1
Sequence:CCGGCTGTGGATGTAACTCAGGATTCTCGAGAATCCTGAGTTACATCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-1654s21c1
Sequence:CCGGCTATATCCGGTCCCGCTATAACTCGAGTTATAGCGGGACCGGATATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-1541s21c1
Sequence:CCGGGTTCGTCCCAATGACTATTTGCTCGAGCAAATAGTCATTGGGACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-404s21c1
Sequence:CCGGGATGTAACTCAGGATTATAATCTCGAGATTATAATCCTGAGTTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-2339s21c1
Sequence:CCGGCATCTGCTGTGCGCCTCTAATCTCGAGATTAGAGGCGCACAGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-487s21c1
Sequence:CCGGCCGCTGGGCTGAGGAATATTTCTCGAGAAATATTCCTCAGCCCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000319
VALIDATED
PEX5 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000319.3-2374s1c1
Sequence:CCGGGCCTCTAATGTCTGTCTGGATCTCGAGATCCAGACAGACATTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-1833s1c1
Sequence:CCGGCCTGCGTTTGGCATTGTCTATCTCGAGATAGACAATGCCAAACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-844s1c1
Sequence:CCGGGCCCTTGATATGGAGTTTGAACTCGAGTTCAAACTCCATATCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-312s1c1
Sequence:CCGGGCAGCAGATTGAGCAGTCAAACTCGAGTTTGACTGCTCAATCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-422s1c1
Sequence:CCGGCTGTGGATGTAACTCAGGATTCTCGAGAATCCTGAGTTACATCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-1654s21c1
Sequence:CCGGCTATATCCGGTCCCGCTATAACTCGAGTTATAGCGGGACCGGATATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-1541s21c1
Sequence:CCGGGTTCGTCCCAATGACTATTTGCTCGAGCAAATAGTCATTGGGACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-404s21c1
Sequence:CCGGGATGTAACTCAGGATTATAATCTCGAGATTATAATCCTGAGTTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-2339s21c1
Sequence:CCGGCATCTGCTGTGCGCCTCTAATCTCGAGATTAGAGGCGCACAGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-487s21c1
Sequence:CCGGCCGCTGGGCTGAGGAATATTTCTCGAGAAATATTCCTCAGCCCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000319
VALIDATED
PEX5 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000319.3-2374s1c1
Sequence:CCGGGCCTCTAATGTCTGTCTGGATCTCGAGATCCAGACAGACATTAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-1833s1c1
Sequence:CCGGCCTGCGTTTGGCATTGTCTATCTCGAGATAGACAATGCCAAACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-844s1c1
Sequence:CCGGGCCCTTGATATGGAGTTTGAACTCGAGTTCAAACTCCATATCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-312s1c1
Sequence:CCGGGCAGCAGATTGAGCAGTCAAACTCGAGTTTGACTGCTCAATCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000319.3-422s1c1
Sequence:CCGGCTGTGGATGTAACTCAGGATTCTCGAGAATCCTGAGTTACATCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-1654s21c1
Sequence:CCGGCTATATCCGGTCCCGCTATAACTCGAGTTATAGCGGGACCGGATATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-1541s21c1
Sequence:CCGGGTTCGTCCCAATGACTATTTGCTCGAGCAAATAGTCATTGGGACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-404s21c1
Sequence:CCGGGATGTAACTCAGGATTATAATCTCGAGATTATAATCCTGAGTTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-2339s21c1
Sequence:CCGGCATCTGCTGTGCGCCTCTAATCTCGAGATTAGAGGCGCACAGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000319.4-487s21c1
Sequence:CCGGCCGCTGGGCTGAGGAATATTTCTCGAGAAATATTCCTCAGCCCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)