EMAIL THIS PAGE TO A FRIEND

PEX6

peroxisomal biogenesis factor 6

79 Gene Product Result for
Synonyms: PAF-2 PAF2 PBD4A PDB4B PXAAA1
UniProtKB ID: Q13608, Q8WYQ2, Q99476
Gene ID:
Human(5190) Summary: This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. [provided by RefSeq, Oct 2008]
Mouse(224824) peroxisomal biogenesis factor 6
Rat(117265) peroxisomal biogenesis factor 6
fruit fly(3772165) Peroxin 6
domestic cat(101092854) peroxisomal biogenesis factor 6
dog(481805) peroxisomal biogenesis factor 6
Zebrafish(792998) peroxisomal biogenesis factor 6
chicken(416709) peroxisomal biogenesis factor 6
Thale Cress(839315) peroxisome biogenesis protein 6
domestic guinea pig(100735669) peroxisomal biogenesis factor 6
naked mole-rat(101697832) peroxisomal biogenesis factor 6
cow(534944) peroxisomal biogenesis factor 6
sheep(101111400) peroxisomal biogenesis factor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA025924 Anti-PEX6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation rat, mouse, human
immunohistochemistry, western blot pricing
SAB2701051 Anti-PEX6 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB5201599 Monoclonal Anti-Pex6 - Alkaline Phosphatase antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB5201600 Monoclonal Anti-Pex6 - Apc antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB5201591 Monoclonal Anti-Pex6 - Atto 390 antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB5201592 Monoclonal Anti-Pex6 - Atto 488 antibody produced in mouse clone S233-8, purified immunoglobulin human, rat
immunocytochemistry, western blot pricing
SAB5201593 Monoclonal Anti-Pex6 - Atto 565 antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB5201594 Monoclonal Anti-Pex6 - Atto 594 antibody produced in mouse clone S233-8, purified immunoglobulin human, rat
immunocytochemistry, western blot pricing
SAB5201595 Monoclonal Anti-Pex6 - Atto 633 antibody produced in mouse clone S233-8, purified immunoglobulin human, rat
immunocytochemistry, western blot pricing
SAB5201596 Monoclonal Anti-Pex6 - Atto 655 antibody produced in mouse clone S233-8, purified immunoglobulin human, rat
immunocytochemistry, western blot pricing
SAB5201597 Monoclonal Anti-Pex6 - Atto 680 antibody produced in mouse clone S233-8, purified immunoglobulin human, rat
immunocytochemistry, western blot pricing
SAB5201598 Monoclonal Anti-Pex6 - Atto 700 antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB5201601 Monoclonal Anti-Pex6 - Biotin antibody produced in mouse clone S233-8, purified immunoglobulin human, rat
immunocytochemistry, western blot pricing
SAB5201602 Monoclonal Anti-Pex6 - Fitc antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB5201603 Monoclonal Anti-Pex6 - Hrp antibody produced in mouse clone S233-8, purified immunoglobulin human, rat
immunocytochemistry, western blot pricing
SAB5201604 Monoclonal Anti-Pex6 - Pe/Atto 594 antibody produced in mouse clone S233-8, purified immunoglobulin human, rat
immunocytochemistry, western blot pricing
SAB5201605 Monoclonal Anti-Pex6 - Percp antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB5201606 Monoclonal Anti-Pex6 - Rpe antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB5201607 Monoclonal Anti-Pex6 - Streptavidin antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB5201590 Monoclonal Anti-Pex6 antibody produced in mouse clone S233-8, purified immunoglobulin rat, human
immunocytochemistry, western blot pricing
SAB1400201 Monoclonal Anti-PEX6 antibody produced in mouse clone 3G3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000287 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000287 Rosetta Predictions human pricing
NM_057125 Rosetta Predictions rat pricing
XM_579594 Rosetta Predictions rat pricing
NM_145488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125574 predicted 979
2 SASI_Hs01_00125575 predicted 2673
3 SASI_Hs01_00125576 predicted 1425
4 SASI_Hs01_00125577 predicted 994
5 SASI_Hs01_00125578 predicted 2522
6 SASI_Hs01_00125579 predicted 2181
7 SASI_Hs02_00302250 predicted 2922
8 SASI_Hs01_00125581 predicted 1073
9 SASI_Hs01_00125582 predicted 998
10 SASI_Hs01_00125583 predicted 750
11 SASI_Hs01_00125580 predicted 2813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079090 predicted 889
2 SASI_Rn01_00079091 predicted 554
3 SASI_Rn01_00079092 predicted 823
4 SASI_Rn01_00079093 predicted 893
5 SASI_Rn01_00079094 predicted 2324
6 SASI_Rn01_00079095 predicted 2192
7 SASI_Rn01_00079096 predicted 2933
8 SASI_Rn01_00079099 predicted 2472
9 SASI_Rn02_00267070 predicted 1965
10 SASI_Rn02_00267071 predicted 706
11 SASI_Rn01_00079097 predicted 2437
12 SASI_Rn01_00079098 predicted 2221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152324 predicted 1241
2 SASI_Rn01_00152325 predicted 1259
3 SASI_Rn01_00152326 predicted 1546
4 SASI_Rn01_00152327 predicted 1468
5 SASI_Rn01_00152328 predicted 1122
6 SASI_Rn01_00152329 predicted 1686
7 SASI_Rn01_00152330 predicted 983
8 SASI_Rn01_00152331 predicted 1874
9 SASI_Rn01_00152332 predicted 1374
10 SASI_Rn01_00152333 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120360 predicted 1694
2 SASI_Mm01_00120361 predicted 2383
3 SASI_Mm01_00120363 predicted 2960
4 SASI_Mm01_00120364 predicted 1027
5 SASI_Mm01_00120365 predicted 2429
6 SASI_Mm01_00120366 predicted 1030
7 SASI_Mm01_00120367 predicted 1367
8 SASI_Mm02_00340905 predicted 2241
9 SASI_Mm02_00340906 predicted 2425
10 SASI_Mm01_00120369 predicted 2622
11 SASI_Mm01_00120362 predicted 1411
12 SASI_Mm01_00120368 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000287
PEX6 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-683s1c1
Sequence:CCGGCCAGAGAGTCATCGAACACTTCTCGAGAAGTGTTCGATGACTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000287.2-3105s1c1
Sequence:CCGGCAGCAACAGCTCAAGAGATATCTCGAGATATCTCTTGAGCTGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-952s1c1
Sequence:CCGGGCCAGAGAGTTACACATCGAACTCGAGTTCGATGTGTAACTCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-2690s1c1
Sequence:CCGGGCCTGGTAAACGTGCTAGATTCTCGAGAATCTAGCACGTTTACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-2311s1c1
Sequence:CCGGCCAGAGCTCATTAACATGTATCTCGAGATACATGTTAATGAGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000287
PEX6 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-683s1c1
Sequence:CCGGCCAGAGAGTCATCGAACACTTCTCGAGAAGTGTTCGATGACTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000287.2-3105s1c1
Sequence:CCGGCAGCAACAGCTCAAGAGATATCTCGAGATATCTCTTGAGCTGTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-952s1c1
Sequence:CCGGGCCAGAGAGTTACACATCGAACTCGAGTTCGATGTGTAACTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-2690s1c1
Sequence:CCGGGCCTGGTAAACGTGCTAGATTCTCGAGAATCTAGCACGTTTACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-2311s1c1
Sequence:CCGGCCAGAGCTCATTAACATGTATCTCGAGATACATGTTAATGAGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000287
PEX6 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-683s1c1
Sequence:CCGGCCAGAGAGTCATCGAACACTTCTCGAGAAGTGTTCGATGACTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000287.2-3105s1c1
Sequence:CCGGCAGCAACAGCTCAAGAGATATCTCGAGATATCTCTTGAGCTGTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-952s1c1
Sequence:CCGGGCCAGAGAGTTACACATCGAACTCGAGTTCGATGTGTAACTCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-2690s1c1
Sequence:CCGGGCCTGGTAAACGTGCTAGATTCTCGAGAATCTAGCACGTTTACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000287.2-2311s1c1
Sequence:CCGGCCAGAGCTCATTAACATGTATCTCGAGATACATGTTAATGAGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145488
VALIDATED
PEX6 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-1037s1c1
Sequence:CCGGGCTAATGGAAATTATGACCATCTCGAGATGGTCATAATTTCCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-1030s1c1
Sequence:CCGGCTACAGTGCTAATGGAAATTACTCGAGTAATTTCCATTAGCACTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-995s1c1
Sequence:CCGGCGAGAGTTACACATTGAGATTCTCGAGAATCTCAATGTGTAACTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-2177s1c1
Sequence:CCGGGTGAAGAAGGAGATCCTAGAACTCGAGTTCTAGGATCTCCTTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-1030s21c1
Sequence:CCGGCTACAGTGCTAATGGAAATTACTCGAGTAATTTCCATTAGCACTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-2952s21c1
Sequence:CCGGAGCGCATCCAACGCAAGTTTGCTCGAGCAAACTTGCGTTGGATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-995s21c1
Sequence:CCGGCGAGAGTTACACATTGAGATTCTCGAGAATCTCAATGTGTAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-2177s21c1
Sequence:CCGGGTGAAGAAGGAGATCCTAGAACTCGAGTTCTAGGATCTCCTTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-1781s21c1
Sequence:CCGGACCGATGTGCAGACGGCATTTCTCGAGAAATGCCGTCTGCACATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145488
VALIDATED
PEX6 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-1037s1c1
Sequence:CCGGGCTAATGGAAATTATGACCATCTCGAGATGGTCATAATTTCCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-1030s1c1
Sequence:CCGGCTACAGTGCTAATGGAAATTACTCGAGTAATTTCCATTAGCACTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-995s1c1
Sequence:CCGGCGAGAGTTACACATTGAGATTCTCGAGAATCTCAATGTGTAACTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-2177s1c1
Sequence:CCGGGTGAAGAAGGAGATCCTAGAACTCGAGTTCTAGGATCTCCTTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-1030s21c1
Sequence:CCGGCTACAGTGCTAATGGAAATTACTCGAGTAATTTCCATTAGCACTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-2952s21c1
Sequence:CCGGAGCGCATCCAACGCAAGTTTGCTCGAGCAAACTTGCGTTGGATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-995s21c1
Sequence:CCGGCGAGAGTTACACATTGAGATTCTCGAGAATCTCAATGTGTAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-2177s21c1
Sequence:CCGGGTGAAGAAGGAGATCCTAGAACTCGAGTTCTAGGATCTCCTTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-1781s21c1
Sequence:CCGGACCGATGTGCAGACGGCATTTCTCGAGAAATGCCGTCTGCACATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145488
VALIDATED
PEX6 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-1037s1c1
Sequence:CCGGGCTAATGGAAATTATGACCATCTCGAGATGGTCATAATTTCCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-1030s1c1
Sequence:CCGGCTACAGTGCTAATGGAAATTACTCGAGTAATTTCCATTAGCACTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-995s1c1
Sequence:CCGGCGAGAGTTACACATTGAGATTCTCGAGAATCTCAATGTGTAACTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145488.1-2177s1c1
Sequence:CCGGGTGAAGAAGGAGATCCTAGAACTCGAGTTCTAGGATCTCCTTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-1030s21c1
Sequence:CCGGCTACAGTGCTAATGGAAATTACTCGAGTAATTTCCATTAGCACTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-2952s21c1
Sequence:CCGGAGCGCATCCAACGCAAGTTTGCTCGAGCAAACTTGCGTTGGATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-995s21c1
Sequence:CCGGCGAGAGTTACACATTGAGATTCTCGAGAATCTCAATGTGTAACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-2177s21c1
Sequence:CCGGGTGAAGAAGGAGATCCTAGAACTCGAGTTCTAGGATCTCCTTCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145488.1-1781s21c1
Sequence:CCGGACCGATGTGCAGACGGCATTTCTCGAGAAATGCCGTCTGCACATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)