EMAIL THIS PAGE TO A FRIEND

PEX7

peroxisomal biogenesis factor 7

72 Gene Product Result for
Synonyms: PBD9B PTS2R RCDP1 RD
UniProtKB ID: O00628
Gene ID:
Human(5191) Summary: This gene encodes the cytosolic receptor for the set of peroxisomal matrix enzymes targeted to the organelle by the peroxisome targeting signal 2 (PTS2). Defects in this gene cause peroxisome biogenesis disorders (PBDs), which are characterized by multiple defects in peroxisome function. There are at least 14 complementation groups for PBDs, with more than one phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene have been associated with PBD complementation group 11 (PBD-CG11) disorders, rhizomelic chondrodysplasia punctata type 1 (RCDP1), and Refsum disease (RD). [provided by RefSeq, Oct 2008]
Mouse(18634) peroxisomal biogenesis factor 7
Rat(308718) peroxisomal biogenesis factor 7
cow(533077) peroxisomal biogenesis factor 7
sheep(101121271) peroxisomal biogenesis factor 7
naked mole-rat(101710222) peroxisomal biogenesis factor 7
Domestic Rabbit(100340758) peroxisomal biogenesis factor 7
domestic guinea pig(100721518) peroxisomal biogenesis factor 7
fruit fly(38994) Peroxin 7
domestic cat(101086311) peroxisomal biogenesis factor 7
dog(484000) peroxisomal biogenesis factor 7
chicken(421687) peroxisomal biogenesis factor 7
Zebrafish(541405) peroxisomal biogenesis factor 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000288 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000288 Rosetta Predictions human pricing
NM_001034147 Rosetta Predictions rat pricing
NM_008822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111019 predicted 512
2 SASI_Hs01_00111020 predicted 806
3 SASI_Hs01_00111021 predicted 480
4 SASI_Hs01_00111022 predicted 753
5 SASI_Hs01_00111023 predicted 1015
6 SASI_Hs01_00111024 predicted 670
7 SASI_Hs01_00111025 predicted 282
8 SASI_Hs01_00111027 predicted 538
9 SASI_Hs01_00111028 predicted 874
10 SASI_Hs02_00302251 predicted 1098
11 SASI_Hs01_00111026 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066310 predicted 625
2 SASI_Rn01_00066311 predicted 436
3 SASI_Rn01_00066312 predicted 240
4 SASI_Rn01_00066313 predicted 824
5 SASI_Rn01_00066314 predicted 1055
6 SASI_Rn01_00066316 predicted 761
7 SASI_Rn01_00066318 predicted 705
8 SASI_Rn02_00204001 predicted 787
9 SASI_Rn01_00066319 predicted 770
10 SASI_Rn02_00204002 predicted 1041
11 SASI_Rn01_00066315 predicted 469
12 SASI_Rn01_00066317 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160587 predicted 285
2 SASI_Mm02_00314758 predicted 262
3 SASI_Mm01_00160588 predicted 483
4 SASI_Mm01_00160589 predicted 484
5 SASI_Mm01_00160590 predicted 672
6 SASI_Mm01_00160591 predicted 802
7 SASI_Mm01_00160592 predicted 1110
8 SASI_Mm01_00160593 predicted 230
9 SASI_Mm01_00160594 predicted 925
10 SASI_Mm01_00160595 predicted 1109
11 SASI_Mm01_00160596 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000288
VALIDATED
PEX7 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000288.3-1115s21c1
Sequence:CCGGGAACTGCCTAACAGCAAATAACTCGAGTTATTTGCTGTTAGGCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-433s21c1
Sequence:CCGGGCTCAGGAGGTGTATAGTGTTCTCGAGAACACTATACACCTCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-946s21c1
Sequence:CCGGGTGGAGCATCATACAGAGTTTCTCGAGAAACTCTGTATGATGCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-664s21c1
Sequence:CCGGGCAGGAGTAAGAATCGTGATTCTCGAGAATCACGATTCTTACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-244s21c1
Sequence:CCGGCTACTAATATTGGATCCAGATCTCGAGATCTGGATCCAATATTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000288.1-1094s1c1
Sequence:CCGGGAACTGCCTAACAGCAAATAACTCGAGTTATTTGCTGTTAGGCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000288.1-925s1c1
Sequence:CCGGGTGGAGCATCATACAGAGTTTCTCGAGAAACTCTGTATGATGCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000288.1-223s1c1
Sequence:CCGGCTACTAATATTGGATCCAGATCTCGAGATCTGGATCCAATATTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000288.1-412s1c1
Sequence:CCGGGCTCAGGAGGTGTATAGTGTTCTCGAGAACACTATACACCTCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000288.1-643s1c1
Sequence:CCGGGCAGGAGTAAGAATCGTGATTCTCGAGAATCACGATTCTTACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000288
VALIDATED
PEX7 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000288.3-1115s21c1
Sequence:CCGGGAACTGCCTAACAGCAAATAACTCGAGTTATTTGCTGTTAGGCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-433s21c1
Sequence:CCGGGCTCAGGAGGTGTATAGTGTTCTCGAGAACACTATACACCTCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-946s21c1
Sequence:CCGGGTGGAGCATCATACAGAGTTTCTCGAGAAACTCTGTATGATGCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-664s21c1
Sequence:CCGGGCAGGAGTAAGAATCGTGATTCTCGAGAATCACGATTCTTACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-244s21c1
Sequence:CCGGCTACTAATATTGGATCCAGATCTCGAGATCTGGATCCAATATTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000288.1-1094s1c1
Sequence:CCGGGAACTGCCTAACAGCAAATAACTCGAGTTATTTGCTGTTAGGCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000288.1-925s1c1
Sequence:CCGGGTGGAGCATCATACAGAGTTTCTCGAGAAACTCTGTATGATGCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000288.1-223s1c1
Sequence:CCGGCTACTAATATTGGATCCAGATCTCGAGATCTGGATCCAATATTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000288.1-412s1c1
Sequence:CCGGGCTCAGGAGGTGTATAGTGTTCTCGAGAACACTATACACCTCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000288.1-643s1c1
Sequence:CCGGGCAGGAGTAAGAATCGTGATTCTCGAGAATCACGATTCTTACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000288
VALIDATED
PEX7 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000288.3-1115s21c1
Sequence:CCGGGAACTGCCTAACAGCAAATAACTCGAGTTATTTGCTGTTAGGCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-433s21c1
Sequence:CCGGGCTCAGGAGGTGTATAGTGTTCTCGAGAACACTATACACCTCCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-946s21c1
Sequence:CCGGGTGGAGCATCATACAGAGTTTCTCGAGAAACTCTGTATGATGCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-664s21c1
Sequence:CCGGGCAGGAGTAAGAATCGTGATTCTCGAGAATCACGATTCTTACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000288.3-244s21c1
Sequence:CCGGCTACTAATATTGGATCCAGATCTCGAGATCTGGATCCAATATTAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000288.1-1094s1c1
Sequence:CCGGGAACTGCCTAACAGCAAATAACTCGAGTTATTTGCTGTTAGGCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000288.1-925s1c1
Sequence:CCGGGTGGAGCATCATACAGAGTTTCTCGAGAAACTCTGTATGATGCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000288.1-223s1c1
Sequence:CCGGCTACTAATATTGGATCCAGATCTCGAGATCTGGATCCAATATTAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000288.1-412s1c1
Sequence:CCGGGCTCAGGAGGTGTATAGTGTTCTCGAGAACACTATACACCTCCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000288.1-643s1c1
Sequence:CCGGGCAGGAGTAAGAATCGTGATTCTCGAGAATCACGATTCTTACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008822
VALIDATED
PEX7 MISSION shRNA Bacterial Glycerol Stock
peroxisomal biogenesis factor 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008822.1-511s1c1
Sequence:CCGGGAAATTCTCTGTGTACCTTTACTCGAGTAAAGGTACACAGAGAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-660s21c1
Sequence:CCGGCCAGCACATCAGACGGAAATCCTCGAGGATTTCCGTCTGATGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-1214s21c1
Sequence:CCGGTATTGTAGTCCTGGTACATAACTCGAGTTATGTACCAGGACTACAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-205s21c1
Sequence:CCGGCGGGCTGTGGAACTCTATTAGCTCGAGCTAATAGAGTTCCACAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-807s21c1
Sequence:CCGGGCTATCAGGAGGGTGAAATTTCTCGAGAAATTTCACCCTCCTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-381s21c1
Sequence:CCGGGGCCCTCTCCAAGTCTATAAACTCGAGTTTATAGACTTGGAGAGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008822.1-411s1c1
Sequence:CCGGCAGGAGGTGTATAGTGTTGATCTCGAGATCAACACTATACACCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008822
VALIDATED
PEX7 MISSION shRNA shRNA Plasmid DNA
peroxisomal biogenesis factor 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008822.1-511s1c1
Sequence:CCGGGAAATTCTCTGTGTACCTTTACTCGAGTAAAGGTACACAGAGAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-660s21c1
Sequence:CCGGCCAGCACATCAGACGGAAATCCTCGAGGATTTCCGTCTGATGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-1214s21c1
Sequence:CCGGTATTGTAGTCCTGGTACATAACTCGAGTTATGTACCAGGACTACAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-205s21c1
Sequence:CCGGCGGGCTGTGGAACTCTATTAGCTCGAGCTAATAGAGTTCCACAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-807s21c1
Sequence:CCGGGCTATCAGGAGGGTGAAATTTCTCGAGAAATTTCACCCTCCTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-381s21c1
Sequence:CCGGGGCCCTCTCCAAGTCTATAAACTCGAGTTTATAGACTTGGAGAGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008822.1-411s1c1
Sequence:CCGGCAGGAGGTGTATAGTGTTGATCTCGAGATCAACACTATACACCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008822
VALIDATED
PEX7 MISSION shRNA Lentiviral Transduction Particles
peroxisomal biogenesis factor 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008822.1-511s1c1
Sequence:CCGGGAAATTCTCTGTGTACCTTTACTCGAGTAAAGGTACACAGAGAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-660s21c1
Sequence:CCGGCCAGCACATCAGACGGAAATCCTCGAGGATTTCCGTCTGATGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-1214s21c1
Sequence:CCGGTATTGTAGTCCTGGTACATAACTCGAGTTATGTACCAGGACTACAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-205s21c1
Sequence:CCGGCGGGCTGTGGAACTCTATTAGCTCGAGCTAATAGAGTTCCACAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-807s21c1
Sequence:CCGGGCTATCAGGAGGGTGAAATTTCTCGAGAAATTTCACCCTCCTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008822.1-381s21c1
Sequence:CCGGGGCCCTCTCCAAGTCTATAAACTCGAGTTTATAGACTTGGAGAGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008822.1-411s1c1
Sequence:CCGGCAGGAGGTGTATAGTGTTGATCTCGAGATCAACACTATACACCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)