EMAIL THIS PAGE TO A FRIEND

PF4

platelet factor 4

58 Gene Product Result for
Synonyms: CXCL4 PF-4 SCYB4
UniProtKB ID: P02776, Q53X61, Q9UC64, Q9UC65
Gene ID:
Human(5196) Summary: This gene encodes a member of the CXC chemokine family. This chemokine is released from the alpha granules of activated platelets in the form of a homotetramer which has high affinity for heparin and is involved in platelet aggregation. This protein is chemotactic for numerous other cell type and also functions as an inhibitor of hematopoiesis, angiogenesis and T-cell function. [provided by RefSeq, Mar 2012]
Mouse(56744) platelet factor 4
Rat(360918) platelet factor 4
cow(507790) platelet factor 4
sheep(101104401) platelet factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112751 MISSION® esiRNA esiRNA human PF4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002619 Rosetta Predictions human pricing
NM_001007729 Rosetta Predictions rat pricing
NM_019932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244105 predicted 317
2 SASI_Hs01_00244106 predicted 325
3 SASI_Hs01_00244107 predicted 323
4 SASI_Hs01_00244108 predicted 323
5 SASI_Hs01_00244109 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049666 predicted 154
2 SASI_Rn01_00049668 predicted 261
3 SASI_Rn01_00049669 predicted 231
4 SASI_Rn01_00049670 predicted 177
5 SASI_Rn01_00049671 predicted 29
6 SASI_Rn01_00049672 predicted 260
7 SASI_Rn01_00049673 predicted 265
8 SASI_Rn01_00049674 predicted 222
9 SASI_Rn01_00049675 predicted 113
10 SASI_Rn02_00198914 predicted 257
11 SASI_Rn01_00049667 predicted 97
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325214 predicted 251
2 SASI_Mm01_00094694 predicted 296
3 SASI_Mm01_00094696 predicted 303
4 SASI_Mm02_00325215 predicted 234
5 SASI_Mm01_00094697 predicted 292
6 SASI_Mm01_00094698 predicted 286
7 SASI_Mm01_00094699 predicted 294
8 SASI_Mm01_00094700 predicted 299
9 SASI_Mm02_00325216 predicted 236
10 SASI_Mm02_00325217 predicted 255
11 SASI_Mm01_00094693 predicted 301
12 SASI_Mm01_00094695 predicted 232
13 SASI_Mm01_00094701 predicted 237
14 SASI_Mm01_00094702 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002619
PF4 MISSION shRNA Bacterial Glycerol Stock
platelet factor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-164s21c1
Sequence:CCGGAGTGCCTGTGTGTGAAGACCACTCGAGTGGTCTTCACACACAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-211s21c1
Sequence:CCGGACCAGCCTGGAGGTGATCAAGCTCGAGCTTGATCACCTCCAGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-230s1c1
Sequence:CCGGACGCTGAAGAATGGAAGGAAACTCGAGTTTCCTTCCATTCTTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-229s1c1
Sequence:CCGGCACGCTGAAGAATGGAAGGAACTCGAGTTCCTTCCATTCTTCAGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-217s1c1
Sequence:CCGGCCAACTGATAGCCACGCTGAACTCGAGTTCAGCGTGGCTATCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-92s1c1
Sequence:CCGGGCCAGCGCTGAAGCTGAAGAACTCGAGTTCTTCAGCTTCAGCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-70s1c1
Sequence:CCGGCCTGCCACTTGTGGTCGCCTTCTCGAGAAGGCGACCACAAGTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-289s21c1
Sequence:CCGGATTTGCTTGGACCTGCAAGCCCTCGAGGGCTTGCAGGTCCAAGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-191s21c1
Sequence:CCGGAGGTCCGTCCCAGGCACATCACTCGAGTGATGTGCCTGGGACGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002619
PF4 MISSION shRNA shRNA Plasmid DNA
platelet factor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-164s21c1
Sequence:CCGGAGTGCCTGTGTGTGAAGACCACTCGAGTGGTCTTCACACACAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-211s21c1
Sequence:CCGGACCAGCCTGGAGGTGATCAAGCTCGAGCTTGATCACCTCCAGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-230s1c1
Sequence:CCGGACGCTGAAGAATGGAAGGAAACTCGAGTTTCCTTCCATTCTTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-229s1c1
Sequence:CCGGCACGCTGAAGAATGGAAGGAACTCGAGTTCCTTCCATTCTTCAGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-217s1c1
Sequence:CCGGCCAACTGATAGCCACGCTGAACTCGAGTTCAGCGTGGCTATCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-92s1c1
Sequence:CCGGGCCAGCGCTGAAGCTGAAGAACTCGAGTTCTTCAGCTTCAGCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-70s1c1
Sequence:CCGGCCTGCCACTTGTGGTCGCCTTCTCGAGAAGGCGACCACAAGTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-289s21c1
Sequence:CCGGATTTGCTTGGACCTGCAAGCCCTCGAGGGCTTGCAGGTCCAAGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-191s21c1
Sequence:CCGGAGGTCCGTCCCAGGCACATCACTCGAGTGATGTGCCTGGGACGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002619
PF4 MISSION shRNA Lentiviral Transduction Particles
platelet factor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-164s21c1
Sequence:CCGGAGTGCCTGTGTGTGAAGACCACTCGAGTGGTCTTCACACACAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-211s21c1
Sequence:CCGGACCAGCCTGGAGGTGATCAAGCTCGAGCTTGATCACCTCCAGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-230s1c1
Sequence:CCGGACGCTGAAGAATGGAAGGAAACTCGAGTTTCCTTCCATTCTTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-229s1c1
Sequence:CCGGCACGCTGAAGAATGGAAGGAACTCGAGTTCCTTCCATTCTTCAGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-217s1c1
Sequence:CCGGCCAACTGATAGCCACGCTGAACTCGAGTTCAGCGTGGCTATCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-92s1c1
Sequence:CCGGGCCAGCGCTGAAGCTGAAGAACTCGAGTTCTTCAGCTTCAGCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002619.1-70s1c1
Sequence:CCGGCCTGCCACTTGTGGTCGCCTTCTCGAGAAGGCGACCACAAGTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-289s21c1
Sequence:CCGGATTTGCTTGGACCTGCAAGCCCTCGAGGGCTTGCAGGTCCAAGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002619.2-191s21c1
Sequence:CCGGAGGTCCGTCCCAGGCACATCACTCGAGTGATGTGCCTGGGACGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019932
PF4 MISSION shRNA Bacterial Glycerol Stock
platelet factor 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-185s1c1
Sequence:CCGGCCCGAAGAAAGCGATGGAGATCTCGAGATCTCCATCGCTTTCTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-243s1c1
Sequence:CCGGTCCATCTTAAGCACATCACCACTCGAGTGGTGATGTGCTTAAGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-304s1c1
Sequence:CCGGCCAGCTCATAGCCACCCTGAACTCGAGTTCAGGGTGGCTATGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-142s1c1
Sequence:CCGGCCTGTTGTTTCTGCCAGCGGTCTCGAGACCGCTGGCAGAAACAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-316s1c1
Sequence:CCGGCACCCTGAAGAATGGGAGGAACTCGAGTTCCTCCCATTCTTCAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019932
PF4 MISSION shRNA shRNA Plasmid DNA
platelet factor 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-185s1c1
Sequence:CCGGCCCGAAGAAAGCGATGGAGATCTCGAGATCTCCATCGCTTTCTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-243s1c1
Sequence:CCGGTCCATCTTAAGCACATCACCACTCGAGTGGTGATGTGCTTAAGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-304s1c1
Sequence:CCGGCCAGCTCATAGCCACCCTGAACTCGAGTTCAGGGTGGCTATGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-142s1c1
Sequence:CCGGCCTGTTGTTTCTGCCAGCGGTCTCGAGACCGCTGGCAGAAACAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-316s1c1
Sequence:CCGGCACCCTGAAGAATGGGAGGAACTCGAGTTCCTCCCATTCTTCAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019932
PF4 MISSION shRNA Lentiviral Transduction Particles
platelet factor 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-185s1c1
Sequence:CCGGCCCGAAGAAAGCGATGGAGATCTCGAGATCTCCATCGCTTTCTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-243s1c1
Sequence:CCGGTCCATCTTAAGCACATCACCACTCGAGTGGTGATGTGCTTAAGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-304s1c1
Sequence:CCGGCCAGCTCATAGCCACCCTGAACTCGAGTTCAGGGTGGCTATGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-142s1c1
Sequence:CCGGCCTGTTGTTTCTGCCAGCGGTCTCGAGACCGCTGGCAGAAACAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019932.1-316s1c1
Sequence:CCGGCACCCTGAAGAATGGGAGGAACTCGAGTTCCTCCCATTCTTCAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)