EMAIL THIS PAGE TO A FRIEND

PFDN1

prefoldin subunit 1

50 Gene Product Result for
Synonyms: PDF PFD1
UniProtKB ID: O60925, B2RD02, Q53F95, Q96EX6
Gene ID:
Human(5201) Summary: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. [provided by RefSeq, Jul 2008]
Mouse(67199) prefoldin 1
Rat(361310) prefoldin subunit 1
Zebrafish(503766) prefoldin subunit 1
dog(606872) prefoldin subunit 1
domestic cat(101093331) prefoldin subunit 1
chicken(416142) prefoldin subunit 1
cow(616553) prefoldin subunit 1
sheep(101117841) prefoldin subunit 1
naked mole-rat(101699291) prefoldin subunit 1
domestic guinea pig(100730576) prefoldin subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002622 Rosetta Predictions human pricing
NM_001108427 Rosetta Predictions rat pricing
NM_026027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092537 predicted 822
2 SASI_Hs01_00092538 predicted 549
3 SASI_Hs02_00334136 predicted 877
4 SASI_Hs01_00092539 predicted 208
5 SASI_Hs01_00092540 predicted 208
6 SASI_Hs01_00092541 predicted 325
7 SASI_Hs01_00092542 predicted 334
8 SASI_Hs01_00092543 predicted 392
9 SASI_Hs01_00092544 predicted 249
10 SASI_Hs01_00092545 predicted 347
11 SASI_Hs01_00092546 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238529 predicted 793
2 SASI_Rn02_00238530 predicted 844
3 SASI_Rn02_00238531 predicted 644
4 SASI_Rn02_00238532 predicted 592
5 SASI_Rn02_00238533 predicted 674
6 SASI_Rn02_00238534 predicted 587
7 SASI_Rn02_00238535 predicted 811
8 SASI_Rn02_00238536 predicted 764
9 SASI_Rn02_00238537 predicted 628
10 SASI_Rn02_00238538 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129065 predicted 699
2 SASI_Mm01_00129066 predicted 324
3 SASI_Mm01_00129067 predicted 776
4 SASI_Mm01_00129068 predicted 689
5 SASI_Mm02_00329499 predicted 380
6 SASI_Mm01_00129070 predicted 393
7 SASI_Mm01_00129071 predicted 629
8 SASI_Mm01_00129072 predicted 515
9 SASI_Mm01_00129073 predicted 397
10 SASI_Mm01_00129074 predicted 597
11 SASI_Mm01_00129069 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002622
VALIDATED
PFDN1 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-328s21c1
Sequence:CCGGCTACCTGGAGCGAAGCGTTAACTCGAGTTAACGCTTCGCTCCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-239s21c1
Sequence:CCGGCTTCAGTCCAAGGAAGCAATTCTCGAGAATTGCTTCCTTGGACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-57s1c1
Sequence:CCGGGCCAAAGTTATTGACACTCAACTCGAGTTGAGTGTCAATAACTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-317s1c1
Sequence:CCGGCGTTAAGGAAGCTGAGGACAACTCGAGTTGTCCTCAGCTTCCTTAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-46s1c1
Sequence:CCGGCAGAGCTTCAAGCCAAAGTTACTCGAGTAACTTTGGCTTGAAGCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-108s1c1
Sequence:CCGGGAACAGCTAAACAGAACGAAACTCGAGTTTCGTTCTGTTTAGCTGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-114s21c1
Sequence:CCGGAGCTCGCAGACATACAGATTGCTCGAGCAATCTGTATGTCTGCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-213s1c1
Sequence:CCGGCTTCAGTCCAAGGAAGCAATTCTCGAGAATTGCTTCCTTGGACTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-703s21c1
Sequence:CCGGCACGCCAGCCAGACCAATAAACTCGAGTTTATTGGTCTGGCTGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002622.4-73s21c1
Sequence:CCGGAGAGCTTCAAGCCAAAGTTATCTCGAGATAACTTTGGCTTGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002622
VALIDATED
PFDN1 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-328s21c1
Sequence:CCGGCTACCTGGAGCGAAGCGTTAACTCGAGTTAACGCTTCGCTCCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-239s21c1
Sequence:CCGGCTTCAGTCCAAGGAAGCAATTCTCGAGAATTGCTTCCTTGGACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-57s1c1
Sequence:CCGGGCCAAAGTTATTGACACTCAACTCGAGTTGAGTGTCAATAACTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-317s1c1
Sequence:CCGGCGTTAAGGAAGCTGAGGACAACTCGAGTTGTCCTCAGCTTCCTTAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-46s1c1
Sequence:CCGGCAGAGCTTCAAGCCAAAGTTACTCGAGTAACTTTGGCTTGAAGCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-108s1c1
Sequence:CCGGGAACAGCTAAACAGAACGAAACTCGAGTTTCGTTCTGTTTAGCTGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-114s21c1
Sequence:CCGGAGCTCGCAGACATACAGATTGCTCGAGCAATCTGTATGTCTGCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-213s1c1
Sequence:CCGGCTTCAGTCCAAGGAAGCAATTCTCGAGAATTGCTTCCTTGGACTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-703s21c1
Sequence:CCGGCACGCCAGCCAGACCAATAAACTCGAGTTTATTGGTCTGGCTGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002622.4-73s21c1
Sequence:CCGGAGAGCTTCAAGCCAAAGTTATCTCGAGATAACTTTGGCTTGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002622
VALIDATED
PFDN1 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-328s21c1
Sequence:CCGGCTACCTGGAGCGAAGCGTTAACTCGAGTTAACGCTTCGCTCCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-239s21c1
Sequence:CCGGCTTCAGTCCAAGGAAGCAATTCTCGAGAATTGCTTCCTTGGACTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-57s1c1
Sequence:CCGGGCCAAAGTTATTGACACTCAACTCGAGTTGAGTGTCAATAACTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-317s1c1
Sequence:CCGGCGTTAAGGAAGCTGAGGACAACTCGAGTTGTCCTCAGCTTCCTTAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-46s1c1
Sequence:CCGGCAGAGCTTCAAGCCAAAGTTACTCGAGTAACTTTGGCTTGAAGCTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-108s1c1
Sequence:CCGGGAACAGCTAAACAGAACGAAACTCGAGTTTCGTTCTGTTTAGCTGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-114s21c1
Sequence:CCGGAGCTCGCAGACATACAGATTGCTCGAGCAATCTGTATGTCTGCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002622.3-213s1c1
Sequence:CCGGCTTCAGTCCAAGGAAGCAATTCTCGAGAATTGCTTCCTTGGACTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002622.4-703s21c1
Sequence:CCGGCACGCCAGCCAGACCAATAAACTCGAGTTTATTGGTCTGGCTGGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002622.4-73s21c1
Sequence:CCGGAGAGCTTCAAGCCAAAGTTATCTCGAGATAACTTTGGCTTGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026027
VALIDATED
PFDN1 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-52s21c1
Sequence:GTACCGGAGAGCTTCAAGCCAAAGTTATCTCGAGATAACTTTGGCTTGAAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-93s21c1
Sequence:CCGGAGCTTGCAGACATACAGATTGCTCGAGCAATCTGTATGTCTGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-219s21c1
Sequence:CCGGTACAGTCCAAGGAAGTAATTCCTCGAGGAATTACTTCCTTGGACTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-634s21c1
Sequence:GTACCGGAGACCAGGTTAGACCAATAAACTCGAGTTTATTGGTCTAACCTGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-167s21c1
Sequence:CCGGACGCTGGTAGATGAGACTAACCTCGAGGTTAGTCTCATCTACCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026027
VALIDATED
PFDN1 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-52s21c1
Sequence:GTACCGGAGAGCTTCAAGCCAAAGTTATCTCGAGATAACTTTGGCTTGAAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-93s21c1
Sequence:CCGGAGCTTGCAGACATACAGATTGCTCGAGCAATCTGTATGTCTGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-219s21c1
Sequence:CCGGTACAGTCCAAGGAAGTAATTCCTCGAGGAATTACTTCCTTGGACTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-634s21c1
Sequence:GTACCGGAGACCAGGTTAGACCAATAAACTCGAGTTTATTGGTCTAACCTGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-167s21c1
Sequence:CCGGACGCTGGTAGATGAGACTAACCTCGAGGTTAGTCTCATCTACCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026027
VALIDATED
PFDN1 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-52s21c1
Sequence:GTACCGGAGAGCTTCAAGCCAAAGTTATCTCGAGATAACTTTGGCTTGAAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-93s21c1
Sequence:CCGGAGCTTGCAGACATACAGATTGCTCGAGCAATCTGTATGTCTGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-219s21c1
Sequence:CCGGTACAGTCCAAGGAAGTAATTCCTCGAGGAATTACTTCCTTGGACTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-634s21c1
Sequence:GTACCGGAGACCAGGTTAGACCAATAAACTCGAGTTTATTGGTCTAACCTGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026027.3-167s21c1
Sequence:CCGGACGCTGGTAGATGAGACTAACCTCGAGGTTAGTCTCATCTACCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)