EMAIL THIS PAGE TO A FRIEND

PFDN2

prefoldin subunit 2

57 Gene Product Result for
Synonyms: PFD2
UniProtKB ID: Q9UHV9, Q9P0P7, Q9UN05
Gene ID:
Human(5202) Summary: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. [provided by RefSeq, Jul 2008]
Mouse(18637) prefoldin 2
Rat(685607) prefoldin subunit 2
domestic guinea pig(100727569) prefoldin subunit 2
naked mole-rat(101708484) prefoldin subunit 2
cow(404138) prefoldin subunit 2
sheep(101102106) prefoldin subunit 2
Zebrafish(323012) prefoldin subunit 2
domestic cat(101092232) prefoldin subunit 2
dog(488648) prefoldin subunit 2
chicken(100858383) prefoldin subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012394 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012394 Rosetta Predictions human pricing
NM_001109476 Rosetta Predictions rat pricing
NM_011070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344201 predicted 229
2 SASI_Hs01_00156243 predicted 209
3 SASI_Hs01_00156245 predicted 211
4 SASI_Hs01_00156246 predicted 204
5 SASI_Hs02_00344202 predicted 210
6 SASI_Hs02_00344203 predicted 239
7 SASI_Hs01_00156239 predicted 225
8 SASI_Hs01_00156240 predicted 231
9 SASI_Hs01_00156241 predicted 242
10 SASI_Hs01_00156242 predicted 228
11 SASI_Hs01_00156238 predicted 354
12 SASI_Hs01_00156244 predicted 335
13 SASI_Hs01_00156247 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248769 predicted 277
2 SASI_Rn02_00248770 predicted 268
3 SASI_Rn02_00248771 predicted 281
4 SASI_Rn02_00248772 predicted 220
5 SASI_Rn02_00248773 predicted 201
6 SASI_Rn02_00248774 predicted 203
7 SASI_Rn02_00248775 predicted 237
8 SASI_Rn02_00248776 predicted 266
9 SASI_Rn02_00248777 predicted 195
10 SASI_Rn02_00248778 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139633 predicted 207
2 SASI_Mm01_00139634 predicted 239
3 SASI_Mm01_00139635 predicted 245
4 SASI_Mm01_00139636 predicted 204
5 SASI_Mm02_00319838 predicted 265
6 SASI_Mm01_00139637 predicted 241
7 SASI_Mm01_00139638 predicted 193
8 SASI_Mm01_00139639 predicted 244
9 SASI_Mm01_00139640 predicted 242
10 SASI_Mm01_00139641 predicted 208
11 SASI_Mm01_00139642 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011070
VALIDATED
PFDN2 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-85s21c1
Sequence:CCGGACAGGTAATTGCTGGCTTTAACTCGAGTTAAAGCCAGCAATTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-284s21c1
Sequence:CCGGGAGGGCAACAAGGAGCAGATACTCGAGTATCTGCTCCTTGTTGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-345s21c1
Sequence:CCGGAGGGCAAAGAACTGAACGAATCTCGAGATTCGTTCAGTTCTTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011070.3-353s1c1
Sequence:CCGGGAACTGAACGAATTCCGGGAACTCGAGTTCCCGGAATTCGTTCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011070.3-345s1c1
Sequence:CCGGAGGGCAAAGAACTGAACGAATCTCGAGATTCGTTCAGTTCTTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011070.3-516s1c1
Sequence:CCGGGATTCCCACTTGTAATTTCTTCTCGAGAAGAAATTACAAGTGGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011070.3-85s1c1
Sequence:CCGGACAGGTAATTGCTGGCTTTAACTCGAGTTAAAGCCAGCAATTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011070.3-284s1c1
Sequence:CCGGGAGGGCAACAAGGAGCAGATACTCGAGTATCTGCTCCTTGTTGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011070.3-516s21c1
Sequence:CCGGGATTCCCACTTGTAATTTCTTCTCGAGAAGAAATTACAAGTGGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-353s21c1
Sequence:CCGGGAACTGAACGAATTCCGGGAACTCGAGTTCCCGGAATTCGTTCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011070
VALIDATED
PFDN2 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-85s21c1
Sequence:CCGGACAGGTAATTGCTGGCTTTAACTCGAGTTAAAGCCAGCAATTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-284s21c1
Sequence:CCGGGAGGGCAACAAGGAGCAGATACTCGAGTATCTGCTCCTTGTTGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-345s21c1
Sequence:CCGGAGGGCAAAGAACTGAACGAATCTCGAGATTCGTTCAGTTCTTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011070.3-353s1c1
Sequence:CCGGGAACTGAACGAATTCCGGGAACTCGAGTTCCCGGAATTCGTTCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011070.3-345s1c1
Sequence:CCGGAGGGCAAAGAACTGAACGAATCTCGAGATTCGTTCAGTTCTTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011070.3-516s1c1
Sequence:CCGGGATTCCCACTTGTAATTTCTTCTCGAGAAGAAATTACAAGTGGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011070.3-85s1c1
Sequence:CCGGACAGGTAATTGCTGGCTTTAACTCGAGTTAAAGCCAGCAATTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011070.3-284s1c1
Sequence:CCGGGAGGGCAACAAGGAGCAGATACTCGAGTATCTGCTCCTTGTTGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011070.3-516s21c1
Sequence:CCGGGATTCCCACTTGTAATTTCTTCTCGAGAAGAAATTACAAGTGGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-353s21c1
Sequence:CCGGGAACTGAACGAATTCCGGGAACTCGAGTTCCCGGAATTCGTTCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011070
VALIDATED
PFDN2 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-85s21c1
Sequence:CCGGACAGGTAATTGCTGGCTTTAACTCGAGTTAAAGCCAGCAATTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-284s21c1
Sequence:CCGGGAGGGCAACAAGGAGCAGATACTCGAGTATCTGCTCCTTGTTGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-345s21c1
Sequence:CCGGAGGGCAAAGAACTGAACGAATCTCGAGATTCGTTCAGTTCTTTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011070.3-353s1c1
Sequence:CCGGGAACTGAACGAATTCCGGGAACTCGAGTTCCCGGAATTCGTTCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011070.3-345s1c1
Sequence:CCGGAGGGCAAAGAACTGAACGAATCTCGAGATTCGTTCAGTTCTTTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011070.3-516s1c1
Sequence:CCGGGATTCCCACTTGTAATTTCTTCTCGAGAAGAAATTACAAGTGGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011070.3-85s1c1
Sequence:CCGGACAGGTAATTGCTGGCTTTAACTCGAGTTAAAGCCAGCAATTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011070.3-284s1c1
Sequence:CCGGGAGGGCAACAAGGAGCAGATACTCGAGTATCTGCTCCTTGTTGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011070.3-516s21c1
Sequence:CCGGGATTCCCACTTGTAATTTCTTCTCGAGAAGAAATTACAAGTGGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011070.3-353s21c1
Sequence:CCGGGAACTGAACGAATTCCGGGAACTCGAGTTCCCGGAATTCGTTCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012394
VALIDATED
PFDN2 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-334s21c1
Sequence:GTACCGGAGCAGATACAGAAGATCATTGCTCGAGCAATGATCTTCTGTATCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_012394.2-194s1c1
Sequence:CCGGGCCTAGTGATCGATACACTGACTCGAGTCAGTGTATCGATCACTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-301s1c1
Sequence:CCGGGAGAACAACAAGGAGCAGATACTCGAGTATCTGCTCCTTGTTGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-313s1c1
Sequence:CCGGGAGCAGATACAGAAGATCATTCTCGAGAATGATCTTCTGTATCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-315s1c1
Sequence:CCGGGCAGATACAGAAGATCATTGACTCGAGTCAATGATCTTCTGTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-327s1c1
Sequence:CCGGGATCATTGAGACACTGACACACTCGAGTGTGTCAGTGTCTCAATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-178s1c1
Sequence:CCGGGAGTTGAATGAGCACAGCCTACTCGAGTAGGCTGTGCTCATTCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-209s21c1
Sequence:CCGGGCACAGCCTAGTGATCGATACCTCGAGGTATCGATCACTAGGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-283s21c1
Sequence:CCGGTGGTGGAGCGAACTGTCAAAGCTCGAGCTTTGACAGTTCGCTCCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-187s21c1
Sequence:CCGGAGTTGGAGATGGAGTTGAATGCTCGAGCATTCAACTCCATCTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-394s1c1
Sequence:CCGGCACAACATTCGTCTCATGGGACTCGAGTCCCATGAGACGAATGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-183s1c1
Sequence:CCGGGAATGAGCACAGCCTAGTGATCTCGAGATCACTAGGCTGTGCTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-239s21c1
Sequence:CCGGGGTAGATGAAACTCGTAAGTGCTCGAGCACTTACGAGTTTCATCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-205s1c1
Sequence:CCGGGATACACTGAAGGAGGTAGATCTCGAGATCTACCTCCTTCAGTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-166s1c1
Sequence:CCGGGAGTTGGAGATGGAGTTGAATCTCGAGATTCAACTCCATCTCCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012394
VALIDATED
PFDN2 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-334s21c1
Sequence:GTACCGGAGCAGATACAGAAGATCATTGCTCGAGCAATGATCTTCTGTATCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_012394.2-194s1c1
Sequence:CCGGGCCTAGTGATCGATACACTGACTCGAGTCAGTGTATCGATCACTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-301s1c1
Sequence:CCGGGAGAACAACAAGGAGCAGATACTCGAGTATCTGCTCCTTGTTGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-313s1c1
Sequence:CCGGGAGCAGATACAGAAGATCATTCTCGAGAATGATCTTCTGTATCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-315s1c1
Sequence:CCGGGCAGATACAGAAGATCATTGACTCGAGTCAATGATCTTCTGTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-327s1c1
Sequence:CCGGGATCATTGAGACACTGACACACTCGAGTGTGTCAGTGTCTCAATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-178s1c1
Sequence:CCGGGAGTTGAATGAGCACAGCCTACTCGAGTAGGCTGTGCTCATTCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-209s21c1
Sequence:CCGGGCACAGCCTAGTGATCGATACCTCGAGGTATCGATCACTAGGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-283s21c1
Sequence:CCGGTGGTGGAGCGAACTGTCAAAGCTCGAGCTTTGACAGTTCGCTCCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-187s21c1
Sequence:CCGGAGTTGGAGATGGAGTTGAATGCTCGAGCATTCAACTCCATCTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-394s1c1
Sequence:CCGGCACAACATTCGTCTCATGGGACTCGAGTCCCATGAGACGAATGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-183s1c1
Sequence:CCGGGAATGAGCACAGCCTAGTGATCTCGAGATCACTAGGCTGTGCTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-239s21c1
Sequence:CCGGGGTAGATGAAACTCGTAAGTGCTCGAGCACTTACGAGTTTCATCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-205s1c1
Sequence:CCGGGATACACTGAAGGAGGTAGATCTCGAGATCTACCTCCTTCAGTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-166s1c1
Sequence:CCGGGAGTTGGAGATGGAGTTGAATCTCGAGATTCAACTCCATCTCCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012394
VALIDATED
PFDN2 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-334s21c1
Sequence:GTACCGGAGCAGATACAGAAGATCATTGCTCGAGCAATGATCTTCTGTATCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_012394.2-194s1c1
Sequence:CCGGGCCTAGTGATCGATACACTGACTCGAGTCAGTGTATCGATCACTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-301s1c1
Sequence:CCGGGAGAACAACAAGGAGCAGATACTCGAGTATCTGCTCCTTGTTGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-313s1c1
Sequence:CCGGGAGCAGATACAGAAGATCATTCTCGAGAATGATCTTCTGTATCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-315s1c1
Sequence:CCGGGCAGATACAGAAGATCATTGACTCGAGTCAATGATCTTCTGTATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-327s1c1
Sequence:CCGGGATCATTGAGACACTGACACACTCGAGTGTGTCAGTGTCTCAATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-178s1c1
Sequence:CCGGGAGTTGAATGAGCACAGCCTACTCGAGTAGGCTGTGCTCATTCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-209s21c1
Sequence:CCGGGCACAGCCTAGTGATCGATACCTCGAGGTATCGATCACTAGGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-283s21c1
Sequence:CCGGTGGTGGAGCGAACTGTCAAAGCTCGAGCTTTGACAGTTCGCTCCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-187s21c1
Sequence:CCGGAGTTGGAGATGGAGTTGAATGCTCGAGCATTCAACTCCATCTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-394s1c1
Sequence:CCGGCACAACATTCGTCTCATGGGACTCGAGTCCCATGAGACGAATGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-183s1c1
Sequence:CCGGGAATGAGCACAGCCTAGTGATCTCGAGATCACTAGGCTGTGCTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012394.3-239s21c1
Sequence:CCGGGGTAGATGAAACTCGTAAGTGCTCGAGCACTTACGAGTTTCATCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-205s1c1
Sequence:CCGGGATACACTGAAGGAGGTAGATCTCGAGATCTACCTCCTTCAGTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012394.2-166s1c1
Sequence:CCGGGAGTTGGAGATGGAGTTGAATCTCGAGATTCAACTCCATCTCCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)