EMAIL THIS PAGE TO A FRIEND

PFDN4

prefoldin subunit 4

56 Gene Product Result for
Synonyms: C1 PFD4
UniProtKB ID: Q9NQP4, Q5TD11, Q92779
Gene ID:
Human(5203) Summary: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. [provided by RefSeq, Jul 2008]
Mouse(109054) prefoldin 4
Rat(100366237) prefoldin subunit 4
Zebrafish(572231) prefoldin subunit 4
chicken(419337) prefoldin subunit 4
dog(477267) prefoldin subunit 4
cow(514621) prefoldin subunit 4
sheep(101120770) prefoldin subunit 4
naked mole-rat(101715033) prefoldin subunit 4
domestic guinea pig(100721210) prefoldin subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002623 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002623 Rosetta Predictions human pricing
NM_001013369 Rosetta Predictions mouse pricing
NM_001110152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094328 predicted 203
2 SASI_Hs01_00094329 predicted 352
3 SASI_Hs01_00094330 predicted 436
4 SASI_Hs01_00094331 predicted 432
5 SASI_Hs01_00094332 predicted 312
6 SASI_Hs01_00094333 predicted 426
7 SASI_Hs02_00334137 predicted 320
8 SASI_Hs01_00094335 predicted 213
9 SASI_Hs01_00094336 predicted 242
10 SASI_Hs01_00094337 predicted 333
11 SASI_Hs01_00094334 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058407 predicted 506
2 SASI_Mm01_00058408 predicted 347
3 SASI_Mm01_00058409 predicted 392
4 SASI_Mm01_00058410 predicted 508
5 SASI_Mm01_00058411 predicted 500
6 SASI_Mm01_00058412 predicted 529
7 SASI_Mm02_00287176 predicted 393
8 SASI_Mm01_00058413 predicted 343
9 SASI_Mm02_00287177 predicted 533
10 SASI_Mm01_00058405 predicted 323
11 SASI_Mm01_00058404 predicted 343
12 SASI_Mm01_00058406 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304776 predicted 347
2 SASI_Mm02_00304777 predicted 763
3 SASI_Mm02_00304778 predicted 576
4 SASI_Mm02_00304779 predicted 571
5 SASI_Mm02_00304780 predicted 598
6 SASI_Mm02_00304781 predicted 465
7 SASI_Mm02_00304782 predicted 412
8 SASI_Mm02_00304783 predicted 605
9 SASI_Mm02_00304784 predicted 389
10 SASI_Mm02_00304785 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002623
VALIDATED
PFDN4 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-437s21c1
Sequence:CCGGCCTTAGAATCCAGAGTGGAATCTCGAGATTCCACTCTGGATTCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-465s21c1
Sequence:CCGGGCGAGTGTTAGCAGATTTGAACTCGAGTTCAAATCTGCTAACACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002623.3-769s21c1
Sequence:CCGGGGCTTCATGTCATGTTATTAACTCGAGTTAATAACATGACATGAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-217s21c1
Sequence:CCGGGCACGGAATACAAGTAGAATCCTCGAGGATTCTACTTGTATTCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-325s21c1
Sequence:CCGGGATTGCTTAATGATACCTTATCTCGAGATAAGGTATCATTAAGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002623.2-298s1c1
Sequence:CCGGGCCTTAGAATCCAGAGTGGAACTCGAGTTCCACTCTGGATTCTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002623.2-232s1c1
Sequence:CCGGCATTCTCAAGAAGAAACGCAACTCGAGTTGCGTTTCTTCTTGAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002623.2-175s1c1
Sequence:CCGGCTTGCAGATGATGATTGCTTACTCGAGTAAGCAATCATCATCTGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002623.2-375s1c1
Sequence:CCGGCAACATAAACCTTGAAGCTGACTCGAGTCAGCTTCAAGGTTTATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002623.2-82s1c1
Sequence:CCGGCGGAATACAAGTAGAATCACACTCGAGTGTGATTCTACTTGTATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002623.2-225s1c1
Sequence:CCGGCATTAGCCATTCTCAAGAAGACTCGAGTCTTCTTGAGAATGGCTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002623.2-299s1c1
Sequence:CCGGCCTTAGAATCCAGAGTGGAATCTCGAGATTCCACTCTGGATTCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002623.2-327s1c1
Sequence:CCGGGCGAGTGTTAGCAGATTTGAACTCGAGTTCAAATCTGCTAACACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002623
VALIDATED
PFDN4 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-437s21c1
Sequence:CCGGCCTTAGAATCCAGAGTGGAATCTCGAGATTCCACTCTGGATTCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-465s21c1
Sequence:CCGGGCGAGTGTTAGCAGATTTGAACTCGAGTTCAAATCTGCTAACACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002623.3-769s21c1
Sequence:CCGGGGCTTCATGTCATGTTATTAACTCGAGTTAATAACATGACATGAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-217s21c1
Sequence:CCGGGCACGGAATACAAGTAGAATCCTCGAGGATTCTACTTGTATTCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-325s21c1
Sequence:CCGGGATTGCTTAATGATACCTTATCTCGAGATAAGGTATCATTAAGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002623.2-298s1c1
Sequence:CCGGGCCTTAGAATCCAGAGTGGAACTCGAGTTCCACTCTGGATTCTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002623.2-232s1c1
Sequence:CCGGCATTCTCAAGAAGAAACGCAACTCGAGTTGCGTTTCTTCTTGAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002623.2-175s1c1
Sequence:CCGGCTTGCAGATGATGATTGCTTACTCGAGTAAGCAATCATCATCTGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002623.2-375s1c1
Sequence:CCGGCAACATAAACCTTGAAGCTGACTCGAGTCAGCTTCAAGGTTTATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002623.2-82s1c1
Sequence:CCGGCGGAATACAAGTAGAATCACACTCGAGTGTGATTCTACTTGTATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002623.2-225s1c1
Sequence:CCGGCATTAGCCATTCTCAAGAAGACTCGAGTCTTCTTGAGAATGGCTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002623.2-299s1c1
Sequence:CCGGCCTTAGAATCCAGAGTGGAATCTCGAGATTCCACTCTGGATTCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002623.2-327s1c1
Sequence:CCGGGCGAGTGTTAGCAGATTTGAACTCGAGTTCAAATCTGCTAACACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002623
VALIDATED
PFDN4 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-437s21c1
Sequence:CCGGCCTTAGAATCCAGAGTGGAATCTCGAGATTCCACTCTGGATTCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-465s21c1
Sequence:CCGGGCGAGTGTTAGCAGATTTGAACTCGAGTTCAAATCTGCTAACACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002623.3-769s21c1
Sequence:CCGGGGCTTCATGTCATGTTATTAACTCGAGTTAATAACATGACATGAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-217s21c1
Sequence:CCGGGCACGGAATACAAGTAGAATCCTCGAGGATTCTACTTGTATTCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002623.3-325s21c1
Sequence:CCGGGATTGCTTAATGATACCTTATCTCGAGATAAGGTATCATTAAGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002623.2-298s1c1
Sequence:CCGGGCCTTAGAATCCAGAGTGGAACTCGAGTTCCACTCTGGATTCTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002623.2-232s1c1
Sequence:CCGGCATTCTCAAGAAGAAACGCAACTCGAGTTGCGTTTCTTCTTGAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002623.2-175s1c1
Sequence:CCGGCTTGCAGATGATGATTGCTTACTCGAGTAAGCAATCATCATCTGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002623.2-375s1c1
Sequence:CCGGCAACATAAACCTTGAAGCTGACTCGAGTCAGCTTCAAGGTTTATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002623.2-82s1c1
Sequence:CCGGCGGAATACAAGTAGAATCACACTCGAGTGTGATTCTACTTGTATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002623.2-225s1c1
Sequence:CCGGCATTAGCCATTCTCAAGAAGACTCGAGTCTTCTTGAGAATGGCTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002623.2-299s1c1
Sequence:CCGGCCTTAGAATCCAGAGTGGAATCTCGAGATTCCACTCTGGATTCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002623.2-327s1c1
Sequence:CCGGGCGAGTGTTAGCAGATTTGAACTCGAGTTCAAATCTGCTAACACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013369
VALIDATED
PFDN4 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013369.1-401s21c1
Sequence:CCGGGAAATGTTAGAAGATGCAAAGCTCGAGCTTTGCATCTTCTAACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013369.1-401s1c1
Sequence:CCGGGAAATGTTAGAAGATGCAAAGCTCGAGCTTTGCATCTTCTAACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013369.1-612s1c1
Sequence:CCGGGATAATTTCCCTTCTCCAAATCTCGAGATTTGGAGAAGGGAAATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013369.1-497s21c1
Sequence:CCGGGTGCAGCTATACGCGAAATTTCTCGAGAAATTTCGCGTATAGCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013369.1-612s21c1
Sequence:CCGGGATAATTTCCCTTCTCCAAATCTCGAGATTTGGAGAAGGGAAATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013369.1-539s21c1
Sequence:CCGGGCAGATGAAAGCTAAACATTTCTCGAGAAATGTTTAGCTTTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013369.1-351s21c1
Sequence:CCGGCCTACCAGATCGGAGACGTTTCTCGAGAAACGTCTCCGATCTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013369.1-389s1c1
Sequence:CCGGGAAGAAACACAGGAAATGTTACTCGAGTAACATTTCCTGTGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013369.1-510s1c1
Sequence:CCGGCGAAATTTGGCAGCAACATAACTCGAGTTATGTTGCTGCCAAATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013369
VALIDATED
PFDN4 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013369.1-401s21c1
Sequence:CCGGGAAATGTTAGAAGATGCAAAGCTCGAGCTTTGCATCTTCTAACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013369.1-401s1c1
Sequence:CCGGGAAATGTTAGAAGATGCAAAGCTCGAGCTTTGCATCTTCTAACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013369.1-612s1c1
Sequence:CCGGGATAATTTCCCTTCTCCAAATCTCGAGATTTGGAGAAGGGAAATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013369.1-497s21c1
Sequence:CCGGGTGCAGCTATACGCGAAATTTCTCGAGAAATTTCGCGTATAGCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013369.1-612s21c1
Sequence:CCGGGATAATTTCCCTTCTCCAAATCTCGAGATTTGGAGAAGGGAAATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013369.1-539s21c1
Sequence:CCGGGCAGATGAAAGCTAAACATTTCTCGAGAAATGTTTAGCTTTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013369.1-351s21c1
Sequence:CCGGCCTACCAGATCGGAGACGTTTCTCGAGAAACGTCTCCGATCTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013369.1-389s1c1
Sequence:CCGGGAAGAAACACAGGAAATGTTACTCGAGTAACATTTCCTGTGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013369.1-510s1c1
Sequence:CCGGCGAAATTTGGCAGCAACATAACTCGAGTTATGTTGCTGCCAAATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013369
VALIDATED
PFDN4 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013369.1-401s21c1
Sequence:CCGGGAAATGTTAGAAGATGCAAAGCTCGAGCTTTGCATCTTCTAACATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013369.1-401s1c1
Sequence:CCGGGAAATGTTAGAAGATGCAAAGCTCGAGCTTTGCATCTTCTAACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216381    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013369.1-612s1c1
Sequence:CCGGGATAATTTCCCTTCTCCAAATCTCGAGATTTGGAGAAGGGAAATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013369.1-497s21c1
Sequence:CCGGGTGCAGCTATACGCGAAATTTCTCGAGAAATTTCGCGTATAGCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013369.1-612s21c1
Sequence:CCGGGATAATTTCCCTTCTCCAAATCTCGAGATTTGGAGAAGGGAAATTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013369.1-539s21c1
Sequence:CCGGGCAGATGAAAGCTAAACATTTCTCGAGAAATGTTTAGCTTTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013369.1-351s21c1
Sequence:CCGGCCTACCAGATCGGAGACGTTTCTCGAGAAACGTCTCCGATCTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013369.1-389s1c1
Sequence:CCGGGAAGAAACACAGGAAATGTTACTCGAGTAACATTTCCTGTGTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013369.1-510s1c1
Sequence:CCGGCGAAATTTGGCAGCAACATAACTCGAGTTATGTTGCTGCCAAATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)