EMAIL THIS PAGE TO A FRIEND

PFDN5

prefoldin subunit 5

81 Gene Product Result for
Synonyms: MM-1 MM1 PFD5
UniProtKB ID: Q99471, A8K9A8, Q54AA8, Q9C083, Q9C084
Gene ID:
Human(5204) Summary: This gene encodes a member of the prefoldin alpha subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. The encoded protein may also repress the transcriptional activity of the proto-oncogene c-Myc. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(56612) prefoldin 5
Rat(300257) prefoldin subunit 5
domestic guinea pig(100732970) prefoldin subunit 5
naked mole-rat(101723617) prefoldin subunit 5
cow(282848) prefoldin subunit 5
sheep(101105486) prefoldin subunit 5
Zebrafish(568182) prefoldin 5
domestic cat(101084372) prefoldin subunit 5
dog(607260) prefoldin subunit 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002624 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027044 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027044 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027044 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002624 Rosetta Predictions human pricing
NM_145896 Rosetta Predictions human pricing
NM_145897 Rosetta Predictions human pricing
NM_001106794 Rosetta Predictions rat pricing
NM_020031 Rosetta Predictions mouse pricing
NM_027044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128077 predicted 308
2 SASI_Hs02_00334138 predicted 202
3 SASI_Hs02_00334139 predicted 412
4 SASI_Hs01_00128078 predicted 208
5 SASI_Hs01_00128080 predicted 255
6 SASI_Hs01_00128084 predicted 289
7 SASI_Hs01_00128085 predicted 314
8 SASI_Hs01_00128086 predicted 374
9 SASI_Hs02_00334140 predicted 256
10 SASI_Hs02_00334141 predicted 302
11 SASI_Hs01_00128079 predicted 376
12 SASI_Hs01_00128081 predicted 236
13 SASI_Hs01_00128082 predicted 302
14 SASI_Hs01_00128083 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214181 predicted 210
2 SASI_Hs01_00214182 predicted 208
3 SASI_Hs01_00214183 predicted 293
4 SASI_Hs01_00214184 predicted 349
5 SASI_Hs01_00214185 predicted 262
6 SASI_Hs01_00214186 predicted 243
7 SASI_Hs01_00214187 predicted 346
8 SASI_Hs01_00214188 predicted 353
9 SASI_Hs01_00214189 predicted 258
10 SASI_Hs01_00214190 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069052 predicted 273
2 SASI_Hs01_00069053 predicted 277
3 SASI_Hs01_00069055 predicted 217
4 SASI_Hs01_00069057 predicted 238
5 SASI_Hs01_00069058 predicted 238
6 SASI_Hs01_00069059 predicted 278
7 SASI_Hs01_00069054 predicted 235
8 SASI_Hs01_00069056 predicted 231
9 SASI_Hs01_00069060 predicted 308
10 SASI_Hs02_00365410 predicted 373
11 SASI_Hs01_00069061 predicted 152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222468 predicted 233
2 SASI_Rn02_00222469 predicted 265
3 SASI_Rn02_00222470 predicted 418
4 SASI_Rn02_00222471 predicted 229
5 SASI_Rn02_00222472 predicted 221
6 SASI_Rn02_00222473 predicted 231
7 SASI_Rn02_00222474 predicted 228
8 SASI_Rn02_00222475 predicted 273
9 SASI_Rn02_00222476 predicted 365
10 SASI_Rn02_00222477 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081075 predicted 445
2 SASI_Mm01_00081076 predicted 447
3 SASI_Mm01_00081077 predicted 442
4 SASI_Mm01_00081078 predicted 437
5 SASI_Mm01_00081079 predicted 447
6 SASI_Mm01_00081080 predicted 448
7 SASI_Mm01_00081081 predicted 438
8 SASI_Mm01_00081082 predicted 444
9 SASI_Mm01_00081083 predicted 92
10 SASI_Mm01_00081084 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331454 predicted 263
2 SASI_Mm02_00331455 predicted 259
3 SASI_Mm02_00331456 predicted 390
4 SASI_Mm01_00133131 predicted 303
5 SASI_Mm02_00331457 predicted 253
6 SASI_Mm01_00133132 predicted 300
7 SASI_Mm02_00331458 predicted 289
8 SASI_Mm02_00331459 predicted 333
9 SASI_Mm02_00331460 predicted 220
10 SASI_Mm02_00331461 predicted 423
11 SASI_Mm01_00133133 predicted 247
12 SASI_Mm01_00133134 predicted 245
13 SASI_Mm01_00133135 predicted 252
14 SASI_Mm01_00133136 predicted 249
15 SASI_Mm01_00133137 predicted 246
16 SASI_Mm01_00133138 predicted 248
17 SASI_Mm01_00133139 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002624
VALIDATED
PFDN5 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002624.3-380s21c1
Sequence:CCGGCTGGGTACTATGTAGAGAAGACTCGAGTCTTCTCTACATAGTACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002624.3-232s21c1
Sequence:CCGGGTACAGACCAAGTATGTGGAACTCGAGTTCCACATACTTGGTCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002624.2-227s1c1
Sequence:CCGGCCCACTGACGAGTTCTATGTACTCGAGTACATAGAACTCGTCAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002624.2-71s1c1
Sequence:CCGGGCCGCAGCTAGAAATGCTCAACTCGAGTTGAGCATTTCTAGCTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002624.2-425s1c1
Sequence:CCGGCGTCATGGAAATGATGAGTCACTCGAGTGACTCATCATTTCCATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002624.2-298s1c1
Sequence:CCGGCTGGGTACTATGTAGAGAAGACTCGAGTCTTCTCTACATAGTACCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002624
VALIDATED
PFDN5 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002624.3-380s21c1
Sequence:CCGGCTGGGTACTATGTAGAGAAGACTCGAGTCTTCTCTACATAGTACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002624.3-232s21c1
Sequence:CCGGGTACAGACCAAGTATGTGGAACTCGAGTTCCACATACTTGGTCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002624.2-227s1c1
Sequence:CCGGCCCACTGACGAGTTCTATGTACTCGAGTACATAGAACTCGTCAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002624.2-71s1c1
Sequence:CCGGGCCGCAGCTAGAAATGCTCAACTCGAGTTGAGCATTTCTAGCTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002624.2-425s1c1
Sequence:CCGGCGTCATGGAAATGATGAGTCACTCGAGTGACTCATCATTTCCATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002624.2-298s1c1
Sequence:CCGGCTGGGTACTATGTAGAGAAGACTCGAGTCTTCTCTACATAGTACCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002624
VALIDATED
PFDN5 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002624.3-380s21c1
Sequence:CCGGCTGGGTACTATGTAGAGAAGACTCGAGTCTTCTCTACATAGTACCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000343207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002624.3-232s21c1
Sequence:CCGGGTACAGACCAAGTATGTGGAACTCGAGTTCCACATACTTGGTCTGTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002624.2-227s1c1
Sequence:CCGGCCCACTGACGAGTTCTATGTACTCGAGTACATAGAACTCGTCAGTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002624.2-71s1c1
Sequence:CCGGGCCGCAGCTAGAAATGCTCAACTCGAGTTGAGCATTTCTAGCTGCGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002624.2-425s1c1
Sequence:CCGGCGTCATGGAAATGATGAGTCACTCGAGTGACTCATCATTTCCATGACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000019058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002624.2-298s1c1
Sequence:CCGGCTGGGTACTATGTAGAGAAGACTCGAGTCTTCTCTACATAGTACCCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027044
VALIDATED
PFDN5 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000334884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027044.3-457s21c1
Sequence:CCGGGCAGGCTGTCATGGAAATGATCTCGAGATCATTTCCATGACAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027044.3-79s21c1
Sequence:CCGGGCAGTCGATTAACATCACGGACTCGAGTCCGTGATGTTAATCGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027044.3-305s21c1
Sequence:CCGGGATGTGGAGCATGTGCTTATTCTCGAGAATAAGCACATGCTCCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027044.3-400s21c1
Sequence:CCGGCCTCACCAAACAGATGGAGAACTCGAGTTCTCCATCTGTTTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027044
VALIDATED
PFDN5 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000334884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027044.3-457s21c1
Sequence:CCGGGCAGGCTGTCATGGAAATGATCTCGAGATCATTTCCATGACAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027044.3-79s21c1
Sequence:CCGGGCAGTCGATTAACATCACGGACTCGAGTCCGTGATGTTAATCGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027044.3-305s21c1
Sequence:CCGGGATGTGGAGCATGTGCTTATTCTCGAGAATAAGCACATGCTCCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027044.3-400s21c1
Sequence:CCGGCCTCACCAAACAGATGGAGAACTCGAGTTCTCCATCTGTTTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027044
VALIDATED
PFDN5 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000334884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027044.3-457s21c1
Sequence:CCGGGCAGGCTGTCATGGAAATGATCTCGAGATCATTTCCATGACAGCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000334882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027044.3-79s21c1
Sequence:CCGGGCAGTCGATTAACATCACGGACTCGAGTCCGTGATGTTAATCGACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000348447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027044.3-305s21c1
Sequence:CCGGGATGTGGAGCATGTGCTTATTCTCGAGAATAAGCACATGCTCCACATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000334883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027044.3-400s21c1
Sequence:CCGGCCTCACCAAACAGATGGAGAACTCGAGTTCTCCATCTGTTTGGTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020031
VALIDATED
PFDN5 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-450s1c1
Sequence:CCGGCATGTGCTTATTGATGTGGGACTCGAGTCCCACATCAATAAGCACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020031.1-171s1c1
Sequence:CCGGCCCACATTTGGGTGGAAGATTCTCGAGAATCTTCCACCCAAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-593s1c1
Sequence:CCGGGCAGGCTGTCATGGAAATGATCTCGAGATCATTTCCATGACAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-215s1c1
Sequence:CCGGGCAGTCGATTAACATCACGGACTCGAGTCCGTGATGTTAATCGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-536s1c1
Sequence:CCGGCCTCACCAAACAGATGGAGAACTCGAGTTCTCCATCTGTTTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020031
VALIDATED
PFDN5 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-450s1c1
Sequence:CCGGCATGTGCTTATTGATGTGGGACTCGAGTCCCACATCAATAAGCACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020031.1-171s1c1
Sequence:CCGGCCCACATTTGGGTGGAAGATTCTCGAGAATCTTCCACCCAAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-593s1c1
Sequence:CCGGGCAGGCTGTCATGGAAATGATCTCGAGATCATTTCCATGACAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-215s1c1
Sequence:CCGGGCAGTCGATTAACATCACGGACTCGAGTCCGTGATGTTAATCGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-536s1c1
Sequence:CCGGCCTCACCAAACAGATGGAGAACTCGAGTTCTCCATCTGTTTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020031
VALIDATED
PFDN5 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-450s1c1
Sequence:CCGGCATGTGCTTATTGATGTGGGACTCGAGTCCCACATCAATAAGCACATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020031.1-171s1c1
Sequence:CCGGCCCACATTTGGGTGGAAGATTCTCGAGAATCTTCCACCCAAATGTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-593s1c1
Sequence:CCGGGCAGGCTGTCATGGAAATGATCTCGAGATCATTTCCATGACAGCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-215s1c1
Sequence:CCGGGCAGTCGATTAACATCACGGACTCGAGTCCGTGATGTTAATCGACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020031.1-536s1c1
Sequence:CCGGCCTCACCAAACAGATGGAGAACTCGAGTTCTCCATCTGTTTGGTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???