EMAIL THIS PAGE TO A FRIEND

PFDN6

prefoldin subunit 6

40 Gene Product Result for
Synonyms: H2-KE2 HKE2 KE-2 PFD6
UniProtKB ID: O15212
Gene ID:
Human(10471) Summary: PFDN6 is a subunit of the heteromeric prefoldin complex that chaperones nascent actin (see MIM 102560) and alpha- and beta-tubulin (see MIM 602529 and MIM 191130, respectively) chains pending their transfer to the cytosolic chaperonin containing TCP1 (MIM 186980) (CCT) complex (Hansen et al., 1999 [PubMed 10209023]
Rat(309629) prefoldin subunit 6
Zebrafish(393485) prefoldin subunit 6
domestic cat(101088333) prefoldin subunit 6
dog(474872) prefoldin subunit 6
cow(509914) prefoldin subunit 6
sheep(101112429) prefoldin subunit 6
naked mole-rat(101720644) prefoldin subunit 6
domestic guinea pig(100730836) prefoldin subunit 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014260 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227921 MISSION® esiRNA esiRNA targeting human PFDN6 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014260 Rosetta Predictions human pricing
NM_212506 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227159 predicted 290
2 SASI_Hs01_00227160 predicted 194
3 SASI_Hs01_00227161 predicted 265
4 SASI_Hs01_00227162 predicted 269
5 SASI_Hs01_00227163 predicted 271
6 SASI_Hs01_00227164 predicted 295
7 SASI_Hs02_00345319 predicted 199
8 SASI_Hs01_00227165 predicted 288
9 SASI_Hs01_00227166 predicted 204
10 SASI_Hs01_00227167 predicted 264
11 SASI_Hs01_00227168 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270496 predicted 266
2 SASI_Rn01_00086848 predicted 242
3 SASI_Rn01_00086849 predicted 294
4 SASI_Rn01_00086850 predicted 344
5 SASI_Rn01_00086851 predicted 249
6 SASI_Rn02_00270497 predicted 328
7 SASI_Rn01_00086854 predicted 219
8 SASI_Rn01_00086855 predicted 342
9 SASI_Rn02_00270498 predicted 345
10 SASI_Rn02_00270499 predicted 276
11 SASI_Rn01_00086852 predicted 245
12 SASI_Rn01_00086853 predicted 351
13 SASI_Rn01_00086856 predicted 336
14 SASI_Rn01_00086857 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014260
PFDN6 MISSION shRNA Bacterial Glycerol Stock
prefoldin subunit 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-177s21c1
Sequence:CCGGAGGACTTAAGTAAATCCATGTCTCGAGACATGGATTTACTTAAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-234s21c1
Sequence:CCGGATAATATCGTGAAAGAGGAACCTCGAGGTTCCTCTTTCACGATATTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-147s21c1
Sequence:CCGGGAGAAGTGGAGAAATATCAACCTCGAGGTTGATATTTCTCCACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-376s21c1
Sequence:CCGGTAAGCGATACGAATCCCAGCTCTCGAGAGCTGGGATTCGTATCGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-368s1c1
Sequence:CCGGGCTGAAATTAAGCGATACGAACTCGAGTTCGTATCGCTTAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-206s1c1
Sequence:CCGGCAGAAACTTGAAGCACAACTACTCGAGTAGTTGTGCTTCAAGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-169s1c1
Sequence:CCGGGCTACAGAAGGACTTAAGTAACTCGAGTTACTTAAGTCCTTCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-278s1c1
Sequence:CCGGGTGGTCTTTAAACTTCTGGGTCTCGAGACCCAGAAGTTTAAAGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-157s1c1
Sequence:CCGGGAAATATCAACAGCTACAGAACTCGAGTTCTGTAGCTGTTGATATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014260
PFDN6 MISSION shRNA shRNA Plasmid DNA
prefoldin subunit 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-177s21c1
Sequence:CCGGAGGACTTAAGTAAATCCATGTCTCGAGACATGGATTTACTTAAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-234s21c1
Sequence:CCGGATAATATCGTGAAAGAGGAACCTCGAGGTTCCTCTTTCACGATATTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-147s21c1
Sequence:CCGGGAGAAGTGGAGAAATATCAACCTCGAGGTTGATATTTCTCCACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-376s21c1
Sequence:CCGGTAAGCGATACGAATCCCAGCTCTCGAGAGCTGGGATTCGTATCGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-368s1c1
Sequence:CCGGGCTGAAATTAAGCGATACGAACTCGAGTTCGTATCGCTTAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-206s1c1
Sequence:CCGGCAGAAACTTGAAGCACAACTACTCGAGTAGTTGTGCTTCAAGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-169s1c1
Sequence:CCGGGCTACAGAAGGACTTAAGTAACTCGAGTTACTTAAGTCCTTCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-278s1c1
Sequence:CCGGGTGGTCTTTAAACTTCTGGGTCTCGAGACCCAGAAGTTTAAAGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-157s1c1
Sequence:CCGGGAAATATCAACAGCTACAGAACTCGAGTTCTGTAGCTGTTGATATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014260
PFDN6 MISSION shRNA Lentiviral Transduction Particles
prefoldin subunit 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-177s21c1
Sequence:CCGGAGGACTTAAGTAAATCCATGTCTCGAGACATGGATTTACTTAAGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-234s21c1
Sequence:CCGGATAATATCGTGAAAGAGGAACCTCGAGGTTCCTCTTTCACGATATTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-147s21c1
Sequence:CCGGGAGAAGTGGAGAAATATCAACCTCGAGGTTGATATTTCTCCACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014260.2-376s21c1
Sequence:CCGGTAAGCGATACGAATCCCAGCTCTCGAGAGCTGGGATTCGTATCGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-368s1c1
Sequence:CCGGGCTGAAATTAAGCGATACGAACTCGAGTTCGTATCGCTTAATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-206s1c1
Sequence:CCGGCAGAAACTTGAAGCACAACTACTCGAGTAGTTGTGCTTCAAGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-169s1c1
Sequence:CCGGGCTACAGAAGGACTTAAGTAACTCGAGTTACTTAAGTCCTTCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-278s1c1
Sequence:CCGGGTGGTCTTTAAACTTCTGGGTCTCGAGACCCAGAAGTTTAAAGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014260.2-157s1c1
Sequence:CCGGGAAATATCAACAGCTACAGAACTCGAGTTCTGTAGCTGTTGATATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)