EMAIL THIS PAGE TO A FRIEND

PFKFB1

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1

65 Gene Product Result for
Synonyms: F6PK HL2K PFRX
UniProtKB ID: P16118, B2RA88, Q5JXS5, Q99951
Gene ID:
Human(5207) Summary: This gene encodes a member of the family of bifunctional 6-phosphofructo-2-kinase:fructose-2,6-biphosphatase enzymes. The enzyme forms a homodimer that catalyzes both the synthesis and degradation of fructose-2,6-biphosphate using independent catalytic domains. Fructose-2,6-biphosphate is an activator of the glycolysis pathway and an inhibitor of the gluconeogenesis pathway. Consequently, regulating fructose-2,6-biphosphate levels through the activity of this enzyme is thought to regulate glucose homeostasis. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2012]
Mouse(18639) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Rat(24638) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Zebrafish(327453) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
chicken(770873) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
dog(491903) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
domestic cat(101094910) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Horse(100062514) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
cow(282304) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
sheep(101116538) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
domestic guinea pig(100722672) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
naked mole-rat(101701867) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Domestic Rabbit(100345023) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_284750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002625 Rosetta Predictions human pricing
NM_012621 Rosetta Predictions rat pricing
NM_008824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187905 predicted 285
2 SASI_Hs01_00187906 predicted 327
3 SASI_Hs01_00187907 predicted 269
4 SASI_Hs02_00334142 predicted 1091
5 SASI_Hs01_00187908 predicted 284
6 SASI_Hs01_00187909 predicted 820
7 SASI_Hs01_00187911 predicted 329
8 SASI_Hs01_00187912 predicted 1458
9 SASI_Hs01_00187913 predicted 241
10 SASI_Hs01_00187914 predicted 1287
11 SASI_Hs01_00187910 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073671 predicted 390
2 SASI_Rn01_00073672 predicted 1263
3 SASI_Rn02_00259824 predicted 427
4 SASI_Rn01_00073674 predicted 381
5 SASI_Rn01_00073675 predicted 1477
6 SASI_Rn01_00073676 predicted 1175
7 SASI_Rn01_00073677 predicted 286
8 SASI_Rn02_00259825 predicted 1427
9 SASI_Rn01_00073678 predicted 1291
10 SASI_Rn01_00073679 predicted 1397
11 SASI_Rn01_00073673 predicted 409
12 SASI_Rn01_00073680 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152041 predicted 284
2 SASI_Mm01_00152042 predicted 1164
3 SASI_Mm01_00152043 predicted 1371
4 SASI_Mm01_00152044 predicted 263
5 SASI_Mm01_00152045 predicted 1321
6 SASI_Mm01_00152046 predicted 925
7 SASI_Mm01_00152047 predicted 662
8 SASI_Mm01_00152048 predicted 1182
9 SASI_Mm01_00152049 predicted 1289
10 SASI_Mm01_00152050 predicted 1079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002625
VALIDATED
PFKFB1 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-1097s21c1
Sequence:CCGGCCAGGAACATTACCCTGAAGACTCGAGTCTTCAGGGTAATGTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-324s21c1
Sequence:CCGGGCAGTGAGCTACAAGAACTATCTCGAGATAGTTCTTGTAGCTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002625.1-1518s1c1
Sequence:CCGGGCCTGTGTCCTCATCGCCTTCCTCGAGGAAGGCGATGAGGACACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-1105s1c1
Sequence:CCGGCCAGGAACATTACCCTGAAGACTCGAGTCTTCAGGGTAATGTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002625.1-1542s1c1
Sequence:CCGGCTTTAGGAAATGCTATCTTTGCTCGAGCAAAGATAGCATTTCCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-916s1c1
Sequence:CCGGCGGCAAGCAGTATGCCTATGCCTCGAGGCATAGGCATACTGCTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-1280s1c1
Sequence:CCGGCTGGCCTATTTCCTGGATAAACTCGAGTTTATCCAGGAAATAGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-1130s1c1
Sequence:CCGGGCACTGCGAGACCAAGATAAACTCGAGTTTATCTTGGTCTCGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002625.1-659s1c1
Sequence:CCGGCTAAAGAGAATTGAGTGCTATCTCGAGATAGCACTCAATTCTCTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-240s1c1
Sequence:CCGGGCAAGACCTATATCTCCACAACTCGAGTTGTGGAGATATAGGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-332s1c1
Sequence:CCGGGCAGTGAGCTACAAGAACTATCTCGAGATAGTTCTTGTAGCTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-908s21c1
Sequence:CCGGCGGCAAGCAGTATGCCTATGCCTCGAGGCATAGGCATACTGCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-232s21c1
Sequence:CCGGGCAAGACCTATATCTCCACAACTCGAGTTGTGGAGATATAGGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002625.1-1527s1c1
Sequence:CCGGCTCATCGCCTTCCACCTTTAGCTCGAGCTAAAGGTGGAAGGCGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002625
VALIDATED
PFKFB1 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-1097s21c1
Sequence:CCGGCCAGGAACATTACCCTGAAGACTCGAGTCTTCAGGGTAATGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-324s21c1
Sequence:CCGGGCAGTGAGCTACAAGAACTATCTCGAGATAGTTCTTGTAGCTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002625.1-1518s1c1
Sequence:CCGGGCCTGTGTCCTCATCGCCTTCCTCGAGGAAGGCGATGAGGACACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-1105s1c1
Sequence:CCGGCCAGGAACATTACCCTGAAGACTCGAGTCTTCAGGGTAATGTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002625.1-1542s1c1
Sequence:CCGGCTTTAGGAAATGCTATCTTTGCTCGAGCAAAGATAGCATTTCCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-916s1c1
Sequence:CCGGCGGCAAGCAGTATGCCTATGCCTCGAGGCATAGGCATACTGCTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-1280s1c1
Sequence:CCGGCTGGCCTATTTCCTGGATAAACTCGAGTTTATCCAGGAAATAGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-1130s1c1
Sequence:CCGGGCACTGCGAGACCAAGATAAACTCGAGTTTATCTTGGTCTCGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002625.1-659s1c1
Sequence:CCGGCTAAAGAGAATTGAGTGCTATCTCGAGATAGCACTCAATTCTCTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-240s1c1
Sequence:CCGGGCAAGACCTATATCTCCACAACTCGAGTTGTGGAGATATAGGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-332s1c1
Sequence:CCGGGCAGTGAGCTACAAGAACTATCTCGAGATAGTTCTTGTAGCTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-908s21c1
Sequence:CCGGCGGCAAGCAGTATGCCTATGCCTCGAGGCATAGGCATACTGCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-232s21c1
Sequence:CCGGGCAAGACCTATATCTCCACAACTCGAGTTGTGGAGATATAGGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002625.1-1527s1c1
Sequence:CCGGCTCATCGCCTTCCACCTTTAGCTCGAGCTAAAGGTGGAAGGCGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002625
VALIDATED
PFKFB1 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-1097s21c1
Sequence:CCGGCCAGGAACATTACCCTGAAGACTCGAGTCTTCAGGGTAATGTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-324s21c1
Sequence:CCGGGCAGTGAGCTACAAGAACTATCTCGAGATAGTTCTTGTAGCTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002625.1-1518s1c1
Sequence:CCGGGCCTGTGTCCTCATCGCCTTCCTCGAGGAAGGCGATGAGGACACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-1105s1c1
Sequence:CCGGCCAGGAACATTACCCTGAAGACTCGAGTCTTCAGGGTAATGTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002625.1-1542s1c1
Sequence:CCGGCTTTAGGAAATGCTATCTTTGCTCGAGCAAAGATAGCATTTCCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-916s1c1
Sequence:CCGGCGGCAAGCAGTATGCCTATGCCTCGAGGCATAGGCATACTGCTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-1280s1c1
Sequence:CCGGCTGGCCTATTTCCTGGATAAACTCGAGTTTATCCAGGAAATAGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-1130s1c1
Sequence:CCGGGCACTGCGAGACCAAGATAAACTCGAGTTTATCTTGGTCTCGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002625.1-659s1c1
Sequence:CCGGCTAAAGAGAATTGAGTGCTATCTCGAGATAGCACTCAATTCTCTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-240s1c1
Sequence:CCGGGCAAGACCTATATCTCCACAACTCGAGTTGTGGAGATATAGGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002625.1-332s1c1
Sequence:CCGGGCAGTGAGCTACAAGAACTATCTCGAGATAGTTCTTGTAGCTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-908s21c1
Sequence:CCGGCGGCAAGCAGTATGCCTATGCCTCGAGGCATAGGCATACTGCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002625.2-232s21c1
Sequence:CCGGGCAAGACCTATATCTCCACAACTCGAGTTGTGGAGATATAGGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002625.1-1527s1c1
Sequence:CCGGCTCATCGCCTTCCACCTTTAGCTCGAGCTAAAGGTGGAAGGCGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008824
VALIDATED
PFKFB1 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-809s21c1
Sequence:CCGGCATGTCACACCTCGATCTATCCTCGAGGATAGATCGAGGTGTGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-279s21c1
Sequence:CCGGCACCGACTAAAGTGTTTAATTCTCGAGAATTAAACACTTTAGTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-1540s21c1
Sequence:CCGGTGCTGGCCTTGTTCTCCTTAACTCGAGTTAAGGAGAACAAGGCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008824.2-358s21c1
Sequence:CCGGCAACATGGAGGCCCAACTTATCTCGAGATAAGTTGGGCCTCCATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-1121s21c1
Sequence:CCGGCTACGGGACCAGGATAAATATCTCGAGATATTTATCCTGGTCCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008824
VALIDATED
PFKFB1 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-809s21c1
Sequence:CCGGCATGTCACACCTCGATCTATCCTCGAGGATAGATCGAGGTGTGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-279s21c1
Sequence:CCGGCACCGACTAAAGTGTTTAATTCTCGAGAATTAAACACTTTAGTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-1540s21c1
Sequence:CCGGTGCTGGCCTTGTTCTCCTTAACTCGAGTTAAGGAGAACAAGGCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008824.2-358s21c1
Sequence:CCGGCAACATGGAGGCCCAACTTATCTCGAGATAAGTTGGGCCTCCATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-1121s21c1
Sequence:CCGGCTACGGGACCAGGATAAATATCTCGAGATATTTATCCTGGTCCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008824
VALIDATED
PFKFB1 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-809s21c1
Sequence:CCGGCATGTCACACCTCGATCTATCCTCGAGGATAGATCGAGGTGTGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-279s21c1
Sequence:CCGGCACCGACTAAAGTGTTTAATTCTCGAGAATTAAACACTTTAGTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-1540s21c1
Sequence:CCGGTGCTGGCCTTGTTCTCCTTAACTCGAGTTAAGGAGAACAAGGCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008824.2-358s21c1
Sequence:CCGGCAACATGGAGGCCCAACTTATCTCGAGATAAGTTGGGCCTCCATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008824.2-1121s21c1
Sequence:CCGGCTACGGGACCAGGATAAATATCTCGAGATATTTATCCTGGTCCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284750
VALIDATED
PFKFB1 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000025624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284750.2-862s1c1
Sequence:CCGGGCCAACTTCATTCGGTCTCAACTCGAGTTGAGACCGAATGAAGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284750.2-1129s1c1
Sequence:CCGGCCAGTTATAATGGAGCTAGAACTCGAGTTCTAGCTCCATTATAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284750.2-639s1c1
Sequence:CCGGCCACCTGTCCTACATCAAGATCTCGAGATCTTGATGTAGGACAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284750.2-448s1c1
Sequence:CCGGCATGGTTACAAGGTCTTCTTTCTCGAGAAAGAAGACCTTGTAACCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284750
VALIDATED
PFKFB1 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000025624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284750.2-862s1c1
Sequence:CCGGGCCAACTTCATTCGGTCTCAACTCGAGTTGAGACCGAATGAAGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284750.2-1129s1c1
Sequence:CCGGCCAGTTATAATGGAGCTAGAACTCGAGTTCTAGCTCCATTATAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284750.2-639s1c1
Sequence:CCGGCCACCTGTCCTACATCAAGATCTCGAGATCTTGATGTAGGACAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284750.2-448s1c1
Sequence:CCGGCATGGTTACAAGGTCTTCTTTCTCGAGAAAGAAGACCTTGTAACCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284750
VALIDATED
PFKFB1 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000025624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284750.2-862s1c1
Sequence:CCGGGCCAACTTCATTCGGTCTCAACTCGAGTTGAGACCGAATGAAGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284750.2-1129s1c1
Sequence:CCGGCCAGTTATAATGGAGCTAGAACTCGAGTTCTAGCTCCATTATAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284750.2-639s1c1
Sequence:CCGGCCACCTGTCCTACATCAAGATCTCGAGATCTTGATGTAGGACAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_284750.2-448s1c1
Sequence:CCGGCATGGTTACAAGGTCTTCTTTCTCGAGAAAGAAGACCTTGTAACCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)