EMAIL THIS PAGE TO A FRIEND

PFKFB3

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3

117 Gene Product Result for
Synonyms: IPFK2 PFK2
UniProtKB ID: Q16875, O43622, O75902, Q5VX15, Q5VX19
Gene ID:
Mouse(170768) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Rat(117276) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Zebrafish(554477) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
chicken(418247) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Horse(100070251) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
domestic cat(101100062) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
dog(487139) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
cow(407183) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
sheep(101107621) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
domestic guinea pig(100726768) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
naked mole-rat(101721976) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Domestic Rabbit(100350534) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004566 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004566 Rosetta Predictions human pricing
NM_057135 Rosetta Predictions rat pricing
NM_133232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065120 predicted 564
2 SASI_Hs01_00065121 predicted 599
3 SASI_Hs01_00065122 predicted 1152
4 SASI_Hs01_00065124 predicted 798
5 SASI_Hs01_00065125 predicted 1580
6 SASI_Hs01_00065126 predicted 610
7 SASI_Hs01_00065127 predicted 1920
8 SASI_Hs01_00065128 predicted 1176
9 SASI_Hs01_00065129 predicted 1973
10 SASI_Hs02_00337893 predicted 842
11 SASI_Hs01_00065123 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113051 predicted 1641
2 SASI_Rn01_00113052 predicted 1514
3 SASI_Rn01_00113053 predicted 1783
4 SASI_Rn01_00113054 predicted 885
5 SASI_Rn01_00113055 predicted 581
6 SASI_Rn01_00113056 predicted 1758
7 SASI_Rn01_00113057 predicted 1033
8 SASI_Rn01_00113058 predicted 1436
9 SASI_Rn01_00113059 predicted 1771
10 SASI_Rn01_00113060 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034119 predicted 2023
2 SASI_Mm02_00338469 predicted 1061
3 SASI_Mm01_00034120 predicted 1476
4 SASI_Mm01_00034121 predicted 604
5 SASI_Mm01_00034122 predicted 1502
6 SASI_Mm01_00034123 predicted 540
7 SASI_Mm01_00034124 predicted 1409
8 SASI_Mm01_00034126 predicted 968
9 SASI_Mm02_00338470 predicted 1214
10 SASI_Mm02_00338471 predicted 670
11 SASI_Mm01_00034125 predicted 2004
12 SASI_Mm01_00034127 predicted 1625
13 SASI_Mm01_00034128 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172976
VALIDATED
PFKFB3 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172976.1-353s1c1
Sequence:CCGGCCACCAATACAACTAGAGAAACTCGAGTTTCTCTAGTTGTATTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172976.1-460s1c1
Sequence:CCGGGCCTCCAACATCATGGAAGTTCTCGAGAACTTCCATGATGTTGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172976.1-1113s1c1
Sequence:CCGGCCAAGAGAATGTATTGGTCATCTCGAGATGACCAATACATTCTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172976.1-178s1c1
Sequence:CCGGGTGTTCAATGTGGGAGAGTATCTCGAGATACTCTCCCACATTGAACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172976.1-675s1c1
Sequence:CCGGCCGAATTGTATACTACCTGATCTCGAGATCAGGTAGTATACAATTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172976
VALIDATED
PFKFB3 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172976.1-353s1c1
Sequence:CCGGCCACCAATACAACTAGAGAAACTCGAGTTTCTCTAGTTGTATTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172976.1-460s1c1
Sequence:CCGGGCCTCCAACATCATGGAAGTTCTCGAGAACTTCCATGATGTTGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172976.1-1113s1c1
Sequence:CCGGCCAAGAGAATGTATTGGTCATCTCGAGATGACCAATACATTCTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172976.1-178s1c1
Sequence:CCGGGTGTTCAATGTGGGAGAGTATCTCGAGATACTCTCCCACATTGAACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172976.1-675s1c1
Sequence:CCGGCCGAATTGTATACTACCTGATCTCGAGATCAGGTAGTATACAATTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172976
VALIDATED
PFKFB3 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172976.1-353s1c1
Sequence:CCGGCCACCAATACAACTAGAGAAACTCGAGTTTCTCTAGTTGTATTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172976.1-460s1c1
Sequence:CCGGGCCTCCAACATCATGGAAGTTCTCGAGAACTTCCATGATGTTGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172976.1-1113s1c1
Sequence:CCGGCCAAGAGAATGTATTGGTCATCTCGAGATGACCAATACATTCTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172976.1-178s1c1
Sequence:CCGGGTGTTCAATGTGGGAGAGTATCTCGAGATACTCTCCCACATTGAACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172976.1-675s1c1
Sequence:CCGGCCGAATTGTATACTACCTGATCTCGAGATCAGGTAGTATACAATTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004566
VALIDATED
PFKFB3 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004566.1-3406s1c1
Sequence:CCGGCGGGTGCATGATTGTGCTTAACTCGAGTTAAGCACAATCATGCACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-598s1c1
Sequence:CCGGGCCTCCAATATCATGGAAGTTCTCGAGAACTTCCATGATATTGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-427s1c1
Sequence:CCGGGCTGCCTTGAGAGATGTCAAACTCGAGTTTGACATCTCTCAAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-354s1c1
Sequence:CCGGGCAGTACAGCTCCTACAACTTCTCGAGAAGTTGTAGGAGCTGTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-630s1c1
Sequence:CCGGCCCGGATTACAAAGACTGCAACTCGAGTTGCAGTCTTTGTAATCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004566.2-3625s1c1
Sequence:CCGGGTGCTTAACTTGGTTGTATTTCTCGAGAAATACAACCAAGTTAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004566.2-2361s1c1
Sequence:CCGGCGTGACTGTTTGGTGCATCTTCTCGAGAAGATGCACCAAACAGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004566.2-4127s1c1
Sequence:CCGGCACGGGCAAAGCTCTTCATTTCTCGAGAAATGAAGAGCTTTGCCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.2-706s1c1
Sequence:CCGGCCACCAATACTACTAGAGAGACTCGAGTCTCTCTAGTAGTATTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004566.2-1899s1c1
Sequence:CCGGCGTGTCGGTTCCATTCCATTTCTCGAGAAATGGAATGGAACCGACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-893s21c1
Sequence:GTACCGGTCTCCAGCCCGGATTACAAAGCTCGAGCTTTGTAATCCGGGCTGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_004566.3-1745s21c1
Sequence:CCGGACCCGCTCATGAGACGCAATACTCGAGTATTGCGTCTCATGAGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-1428s21c1
Sequence:CCGGGGAGCAGGACAAGTACTATTACTCGAGTAATAGTACTTGTCCTGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-1013s21c1
Sequence:CCGGTGTCGCTGATCAAGGTGATTGCTCGAGCAATCACCTTGATCAGCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004566.3-2416s21c1
Sequence:CCGGCGTGACTGTTTGGTGCATCTTCTCGAGAAGATGCACCAAACAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004566.3-1954s21c1
Sequence:CCGGCGTGTCGGTTCCATTCCATTTCTCGAGAAATGGAATGGAACCGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-1598s21c1
Sequence:GTACCGGAGGAGATGCCCTACCTGAAATCTCGAGATTTCAGGTAGGGCATCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004566
VALIDATED
PFKFB3 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004566.1-3406s1c1
Sequence:CCGGCGGGTGCATGATTGTGCTTAACTCGAGTTAAGCACAATCATGCACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-598s1c1
Sequence:CCGGGCCTCCAATATCATGGAAGTTCTCGAGAACTTCCATGATATTGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-427s1c1
Sequence:CCGGGCTGCCTTGAGAGATGTCAAACTCGAGTTTGACATCTCTCAAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-354s1c1
Sequence:CCGGGCAGTACAGCTCCTACAACTTCTCGAGAAGTTGTAGGAGCTGTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-630s1c1
Sequence:CCGGCCCGGATTACAAAGACTGCAACTCGAGTTGCAGTCTTTGTAATCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004566.2-3625s1c1
Sequence:CCGGGTGCTTAACTTGGTTGTATTTCTCGAGAAATACAACCAAGTTAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004566.2-2361s1c1
Sequence:CCGGCGTGACTGTTTGGTGCATCTTCTCGAGAAGATGCACCAAACAGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004566.2-4127s1c1
Sequence:CCGGCACGGGCAAAGCTCTTCATTTCTCGAGAAATGAAGAGCTTTGCCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.2-706s1c1
Sequence:CCGGCCACCAATACTACTAGAGAGACTCGAGTCTCTCTAGTAGTATTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004566.2-1899s1c1
Sequence:CCGGCGTGTCGGTTCCATTCCATTTCTCGAGAAATGGAATGGAACCGACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-893s21c1
Sequence:GTACCGGTCTCCAGCCCGGATTACAAAGCTCGAGCTTTGTAATCCGGGCTGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_004566.3-1745s21c1
Sequence:CCGGACCCGCTCATGAGACGCAATACTCGAGTATTGCGTCTCATGAGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-1428s21c1
Sequence:CCGGGGAGCAGGACAAGTACTATTACTCGAGTAATAGTACTTGTCCTGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-1013s21c1
Sequence:CCGGTGTCGCTGATCAAGGTGATTGCTCGAGCAATCACCTTGATCAGCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004566.3-2416s21c1
Sequence:CCGGCGTGACTGTTTGGTGCATCTTCTCGAGAAGATGCACCAAACAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004566.3-1954s21c1
Sequence:CCGGCGTGTCGGTTCCATTCCATTTCTCGAGAAATGGAATGGAACCGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-1598s21c1
Sequence:GTACCGGAGGAGATGCCCTACCTGAAATCTCGAGATTTCAGGTAGGGCATCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004566
VALIDATED
PFKFB3 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004566.1-3406s1c1
Sequence:CCGGCGGGTGCATGATTGTGCTTAACTCGAGTTAAGCACAATCATGCACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-598s1c1
Sequence:CCGGGCCTCCAATATCATGGAAGTTCTCGAGAACTTCCATGATATTGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-427s1c1
Sequence:CCGGGCTGCCTTGAGAGATGTCAAACTCGAGTTTGACATCTCTCAAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-354s1c1
Sequence:CCGGGCAGTACAGCTCCTACAACTTCTCGAGAAGTTGTAGGAGCTGTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.1-630s1c1
Sequence:CCGGCCCGGATTACAAAGACTGCAACTCGAGTTGCAGTCTTTGTAATCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004566.2-3625s1c1
Sequence:CCGGGTGCTTAACTTGGTTGTATTTCTCGAGAAATACAACCAAGTTAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004566.2-2361s1c1
Sequence:CCGGCGTGACTGTTTGGTGCATCTTCTCGAGAAGATGCACCAAACAGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004566.2-4127s1c1
Sequence:CCGGCACGGGCAAAGCTCTTCATTTCTCGAGAAATGAAGAGCTTTGCCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004566.2-706s1c1
Sequence:CCGGCCACCAATACTACTAGAGAGACTCGAGTCTCTCTAGTAGTATTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004566.2-1899s1c1
Sequence:CCGGCGTGTCGGTTCCATTCCATTTCTCGAGAAATGGAATGGAACCGACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-893s21c1
Sequence:GTACCGGTCTCCAGCCCGGATTACAAAGCTCGAGCTTTGTAATCCGGGCTGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_004566.3-1745s21c1
Sequence:CCGGACCCGCTCATGAGACGCAATACTCGAGTATTGCGTCTCATGAGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-1428s21c1
Sequence:CCGGGGAGCAGGACAAGTACTATTACTCGAGTAATAGTACTTGTCCTGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-1013s21c1
Sequence:CCGGTGTCGCTGATCAAGGTGATTGCTCGAGCAATCACCTTGATCAGCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004566.3-2416s21c1
Sequence:CCGGCGTGACTGTTTGGTGCATCTTCTCGAGAAGATGCACCAAACAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004566.3-1954s21c1
Sequence:CCGGCGTGTCGGTTCCATTCCATTTCTCGAGAAATGGAATGGAACCGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004566.3-1598s21c1
Sequence:GTACCGGAGGAGATGCCCTACCTGAAATCTCGAGATTTCAGGTAGGGCATCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133232
VALIDATED
PFKFB3 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-1478s21c1
Sequence:CCGGGAGCCTGTGATCATGGAATTACTCGAGTAATTCCATGATCACAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-764s21c1
Sequence:CCGGAGAAGGCACATGATCCTTAATCTCGAGATTAAGGATCATGTGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-2378s21c1
Sequence:CCGGTCAGGGACAAGTTGCACATTCCTCGAGGAATGTGCAACTTGTCCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-1053s21c1
Sequence:CCGGACCACATCCAGAGCCGAATTGCTCGAGCAATTCGGCTCTGGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-924s21c1
Sequence:CCGGACTTCATGAAGAGAATCAATTCTCGAGAATTGATTCTCTTCATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-1728s21c1
Sequence:CCGGACCCGCTCATGAGACGCAATACTCGAGTATTGCGTCTCATGAGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-558s21c1
Sequence:CCGGTTCCAACGAAAGTGTTCAATGCTCGAGCATTGAACACTTTCGTTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-1581s21c1
Sequence:CCGGAGGAGATGCCATACCTGAAATCTCGAGATTTCAGGTATGGCATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133232
VALIDATED
PFKFB3 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-1478s21c1
Sequence:CCGGGAGCCTGTGATCATGGAATTACTCGAGTAATTCCATGATCACAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-764s21c1
Sequence:CCGGAGAAGGCACATGATCCTTAATCTCGAGATTAAGGATCATGTGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-2378s21c1
Sequence:CCGGTCAGGGACAAGTTGCACATTCCTCGAGGAATGTGCAACTTGTCCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-1053s21c1
Sequence:CCGGACCACATCCAGAGCCGAATTGCTCGAGCAATTCGGCTCTGGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-924s21c1
Sequence:CCGGACTTCATGAAGAGAATCAATTCTCGAGAATTGATTCTCTTCATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-1728s21c1
Sequence:CCGGACCCGCTCATGAGACGCAATACTCGAGTATTGCGTCTCATGAGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-558s21c1
Sequence:CCGGTTCCAACGAAAGTGTTCAATGCTCGAGCATTGAACACTTTCGTTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-1581s21c1
Sequence:CCGGAGGAGATGCCATACCTGAAATCTCGAGATTTCAGGTATGGCATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133232
VALIDATED
PFKFB3 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-1478s21c1
Sequence:CCGGGAGCCTGTGATCATGGAATTACTCGAGTAATTCCATGATCACAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-764s21c1
Sequence:CCGGAGAAGGCACATGATCCTTAATCTCGAGATTAAGGATCATGTGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-2378s21c1
Sequence:CCGGTCAGGGACAAGTTGCACATTCCTCGAGGAATGTGCAACTTGTCCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-1053s21c1
Sequence:CCGGACCACATCCAGAGCCGAATTGCTCGAGCAATTCGGCTCTGGATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-924s21c1
Sequence:CCGGACTTCATGAAGAGAATCAATTCTCGAGAATTGATTCTCTTCATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133232.2-1728s21c1
Sequence:CCGGACCCGCTCATGAGACGCAATACTCGAGTATTGCGTCTCATGAGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-558s21c1
Sequence:CCGGTTCCAACGAAAGTGTTCAATGCTCGAGCATTGAACACTTTCGTTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133232.2-1581s21c1
Sequence:CCGGAGGAGATGCCATACCTGAAATCTCGAGATTTCAGGTATGGCATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)