EMAIL THIS PAGE TO A FRIEND

PFKFB4

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4

168 Gene Product Result for
UniProtKB ID: Q16877, Q5S3G5
Gene ID:
Mouse(270198) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Rat(54283) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Domestic Rabbit(100345242) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
naked mole-rat(101716744) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
domestic guinea pig(100726420) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
cow(534928) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
sheep(101110626) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Zebrafish(556190) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
chicken(415906) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Horse(100053840) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
domestic cat(101088558) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
dog(484777) 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004567 Rosetta Predictions human pricing
NM_019333 Rosetta Predictions rat pricing
NM_001039215 Rosetta Predictions mouse pricing
NM_001039216 Rosetta Predictions mouse pricing
NM_001039217 Rosetta Predictions mouse pricing
NM_173019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127438 predicted 298
2 SASI_Hs02_00337894 predicted 517
3 SASI_Hs01_00127439 predicted 541
4 SASI_Hs01_00127441 predicted 594
5 SASI_Hs02_00337895 predicted 509
6 SASI_Hs01_00127442 predicted 1298
7 SASI_Hs01_00127443 predicted 261
8 SASI_Hs01_00127444 predicted 641
9 SASI_Hs01_00127445 predicted 1013
10 SASI_Hs01_00127447 predicted 1229
11 SASI_Hs01_00127440 predicted 1525
12 SASI_Hs01_00127446 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069337 predicted 630
2 SASI_Rn01_00069338 predicted 528
3 SASI_Rn01_00069340 predicted 561
4 SASI_Rn01_00069341 predicted 479
5 SASI_Rn01_00069342 predicted 494
6 SASI_Rn02_00262312 predicted 888
7 SASI_Rn01_00069343 predicted 1029
8 SASI_Rn01_00069344 predicted 277
9 SASI_Rn01_00069345 predicted 784
10 SASI_Rn01_00069346 predicted 633
11 SASI_Rn01_00069339 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051196 predicted 307
2 SASI_Mm01_00051197 predicted 411
3 SASI_Mm01_00051198 predicted 322
4 SASI_Mm01_00051199 predicted 314
5 SASI_Mm01_00051200 predicted 236
6 SASI_Mm01_00051201 predicted 527
7 SASI_Mm01_00051202 predicted 468
8 SASI_Mm01_00051203 predicted 497
9 SASI_Mm01_00051204 predicted 222
10 SASI_Mm01_00051205 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193490 predicted 1316
2 SASI_Mm01_00193491 predicted 306
3 SASI_Mm01_00193492 predicted 415
4 SASI_Mm01_00193493 predicted 319
5 SASI_Mm01_00193494 predicted 1329
6 SASI_Mm01_00193495 predicted 1311
7 SASI_Mm01_00193496 predicted 1475
8 SASI_Mm01_00193497 predicted 1322
9 SASI_Mm01_00193498 predicted 316
10 SASI_Mm01_00193499 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152104 predicted 1358
2 SASI_Mm01_00152105 predicted 327
3 SASI_Mm01_00152106 predicted 434
4 SASI_Mm01_00152107 predicted 333
5 SASI_Mm01_00152108 predicted 1364
6 SASI_Mm01_00152109 predicted 1349
7 SASI_Mm01_00152110 predicted 1523
8 SASI_Mm01_00152111 predicted 1361
9 SASI_Mm01_00152112 predicted 339
10 SASI_Mm01_00152113 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345079 predicted 1262
2 SASI_Mm02_00345080 predicted 354
3 SASI_Mm02_00345081 predicted 643
4 SASI_Mm01_00021817 predicted 427
5 SASI_Mm02_00345082 predicted 613
6 SASI_Mm02_00345083 predicted 332
7 SASI_Mm02_00345084 predicted 550
8 SASI_Mm02_00345085 predicted 1398
9 SASI_Mm02_00345086 predicted 354
10 SASI_Mm02_00345087 predicted 317
11 SASI_Mm01_00021814 predicted 1394
12 SASI_Mm01_00021815 predicted 362
13 SASI_Mm01_00021816 predicted 469
14 SASI_Mm01_00021818 predicted 1396
15 SASI_Mm01_00021819 predicted 1388
16 SASI_Mm01_00021820 predicted 1552
17 SASI_Mm01_00021821 predicted 1389
18 SASI_Mm01_00021822 predicted 374
19 SASI_Mm01_00021823 predicted 1364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004567
VALIDATED
PFKFB4 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004567.2-124s21c1
Sequence:CCGGCCAACTGCCCAACTCTCATTGCTCGAGCAATGAGAGTTGGGCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004567.2-617s21c1
Sequence:CCGGCTCCTACGAGTCGCTAGATGACTCGAGTCATCTAGCGACTCGTAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004567.2-593s21c1
Sequence:CCGGGAGGCGCATTGAGTGCTATGACTCGAGTCATAGCACTCAATGCGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004567.2-3341s1c1
Sequence:CCGGGCTGATTGGCTGCCACATTTCCTCGAGGAAATGTGGCAGCCAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-1211s1c1
Sequence:CCGGGCTGGCCTACTTCCTCGACAACTCGAGTTGTCGAGGAAGTAGGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004567.2-863s1c1
Sequence:CCGGCAAGAGTCTAGCCCAGTTCATCTCGAGATGAACTGGGCTAGACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004567.2-451s1c1
Sequence:CCGGGAGAACAGAATGGCTACAAGACTCGAGTCTTGTAGCCATTCTGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-645s1c1
Sequence:CCGGGATAGGGACCTGTCCTATATCCTCGAGGATATAGGACAGGTCCCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004567.2-1706s1c1
Sequence:CCGGGCGCAGCTCTTAGGTGTTCACCTCGAGGTGAACACCTAAGAGCTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-298s1c1
Sequence:CCGGCCGACAATGAAGAGGGCCTGACTCGAGTCAGGCCCTCTTCATTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004567.2-1362s1c1
Sequence:CCGGCCTCAGAACGTGGACATCTCACTCGAGTGAGATGTCCACGTTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004567.2-954s1c1
Sequence:CCGGGCACTGGGTGTGCCCTATGAACTCGAGTTCATAGGGCACACCCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-516s1c1
Sequence:CCGGGCCAACATCGTGCAAGTGAAACTCGAGTTTCACTTGCACGATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-258s1c1
Sequence:CCGGGACGTGGTCAAGACCTACAAACTCGAGTTTGTAGGTCTTGACCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-725s1c1
Sequence:CCGGCCGCATCGTATATTACCTCATCTCGAGATGAGGTAATATACGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004567.2-1290s1c1
Sequence:CCGGCCTGTGGCATATGGTTGTAAACTCGAGTTTACAACCATATGCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004567
VALIDATED
PFKFB4 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004567.2-124s21c1
Sequence:CCGGCCAACTGCCCAACTCTCATTGCTCGAGCAATGAGAGTTGGGCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004567.2-617s21c1
Sequence:CCGGCTCCTACGAGTCGCTAGATGACTCGAGTCATCTAGCGACTCGTAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004567.2-593s21c1
Sequence:CCGGGAGGCGCATTGAGTGCTATGACTCGAGTCATAGCACTCAATGCGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004567.2-3341s1c1
Sequence:CCGGGCTGATTGGCTGCCACATTTCCTCGAGGAAATGTGGCAGCCAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-1211s1c1
Sequence:CCGGGCTGGCCTACTTCCTCGACAACTCGAGTTGTCGAGGAAGTAGGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004567.2-863s1c1
Sequence:CCGGCAAGAGTCTAGCCCAGTTCATCTCGAGATGAACTGGGCTAGACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004567.2-451s1c1
Sequence:CCGGGAGAACAGAATGGCTACAAGACTCGAGTCTTGTAGCCATTCTGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-645s1c1
Sequence:CCGGGATAGGGACCTGTCCTATATCCTCGAGGATATAGGACAGGTCCCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004567.2-1706s1c1
Sequence:CCGGGCGCAGCTCTTAGGTGTTCACCTCGAGGTGAACACCTAAGAGCTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-298s1c1
Sequence:CCGGCCGACAATGAAGAGGGCCTGACTCGAGTCAGGCCCTCTTCATTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004567.2-1362s1c1
Sequence:CCGGCCTCAGAACGTGGACATCTCACTCGAGTGAGATGTCCACGTTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004567.2-954s1c1
Sequence:CCGGGCACTGGGTGTGCCCTATGAACTCGAGTTCATAGGGCACACCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-516s1c1
Sequence:CCGGGCCAACATCGTGCAAGTGAAACTCGAGTTTCACTTGCACGATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-258s1c1
Sequence:CCGGGACGTGGTCAAGACCTACAAACTCGAGTTTGTAGGTCTTGACCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-725s1c1
Sequence:CCGGCCGCATCGTATATTACCTCATCTCGAGATGAGGTAATATACGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004567.2-1290s1c1
Sequence:CCGGCCTGTGGCATATGGTTGTAAACTCGAGTTTACAACCATATGCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004567
VALIDATED
PFKFB4 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004567.2-124s21c1
Sequence:CCGGCCAACTGCCCAACTCTCATTGCTCGAGCAATGAGAGTTGGGCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004567.2-617s21c1
Sequence:CCGGCTCCTACGAGTCGCTAGATGACTCGAGTCATCTAGCGACTCGTAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004567.2-593s21c1
Sequence:CCGGGAGGCGCATTGAGTGCTATGACTCGAGTCATAGCACTCAATGCGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004567.2-3341s1c1
Sequence:CCGGGCTGATTGGCTGCCACATTTCCTCGAGGAAATGTGGCAGCCAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-1211s1c1
Sequence:CCGGGCTGGCCTACTTCCTCGACAACTCGAGTTGTCGAGGAAGTAGGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004567.2-863s1c1
Sequence:CCGGCAAGAGTCTAGCCCAGTTCATCTCGAGATGAACTGGGCTAGACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004567.2-451s1c1
Sequence:CCGGGAGAACAGAATGGCTACAAGACTCGAGTCTTGTAGCCATTCTGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-645s1c1
Sequence:CCGGGATAGGGACCTGTCCTATATCCTCGAGGATATAGGACAGGTCCCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004567.2-1706s1c1
Sequence:CCGGGCGCAGCTCTTAGGTGTTCACCTCGAGGTGAACACCTAAGAGCTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-298s1c1
Sequence:CCGGCCGACAATGAAGAGGGCCTGACTCGAGTCAGGCCCTCTTCATTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004567.2-1362s1c1
Sequence:CCGGCCTCAGAACGTGGACATCTCACTCGAGTGAGATGTCCACGTTCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004567.2-954s1c1
Sequence:CCGGGCACTGGGTGTGCCCTATGAACTCGAGTTCATAGGGCACACCCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-516s1c1
Sequence:CCGGGCCAACATCGTGCAAGTGAAACTCGAGTTTCACTTGCACGATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-258s1c1
Sequence:CCGGGACGTGGTCAAGACCTACAAACTCGAGTTTGTAGGTCTTGACCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004567.2-725s1c1
Sequence:CCGGCCGCATCGTATATTACCTCATCTCGAGATGAGGTAATATACGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004567.2-1290s1c1
Sequence:CCGGCCTGTGGCATATGGTTGTAAACTCGAGTTTACAACCATATGCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173019
PFKFB4 MISSION shRNA Bacterial Glycerol Stock
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-527s21c1
Sequence:GTACCGGGAGCGATGATCTTTAACTTTGCTCGAGCAAAGTTAAAGATCATCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-1113s21c1
Sequence:GTACCGGGGAAATGACCTACGAAGAAATCTCGAGATTTCTTCGTAGGTCATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-1458s21c1
Sequence:GTACCGGACCTCAGAATGTAGACATATCCTCGAGGATATGTCTACATTCTGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-1262s21c1
Sequence:GTACCGGAGGAGAATGTGTTGGTCATTTCTCGAGAAATGACCAACACATTCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173019.5-1776s21c1
Sequence:CCGGCATGACGTTTGCAACCTTAAACTCGAGTTTAAGGTTGCAAACGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-1213s1c1
Sequence:CCGGCAGGAGAATGTGTTGGTCATTCTCGAGAATGACCAACACATTCTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-1350s1c1
Sequence:CCGGCGGTTGTAAAGTGGAGTCCATCTCGAGATGGACTCCACTTTACAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-478s1c1
Sequence:CCGGAGAGCGATGATCTTTAACTTTCTCGAGAAAGTTAAAGATCATCGCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-1409s1c1
Sequence:CCGGGACCTCAGAATGTAGACATATCTCGAGATATGTCTACATTCTGAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-924s1c1
Sequence:CCGGCCAGTTCATCAGTGACCAGAACTCGAGTTCTGGTCACTGATGAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173019
PFKFB4 MISSION shRNA shRNA Plasmid DNA
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-527s21c1
Sequence:GTACCGGGAGCGATGATCTTTAACTTTGCTCGAGCAAAGTTAAAGATCATCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-1113s21c1
Sequence:GTACCGGGGAAATGACCTACGAAGAAATCTCGAGATTTCTTCGTAGGTCATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-1458s21c1
Sequence:GTACCGGACCTCAGAATGTAGACATATCCTCGAGGATATGTCTACATTCTGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-1262s21c1
Sequence:GTACCGGAGGAGAATGTGTTGGTCATTTCTCGAGAAATGACCAACACATTCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173019.5-1776s21c1
Sequence:CCGGCATGACGTTTGCAACCTTAAACTCGAGTTTAAGGTTGCAAACGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-1213s1c1
Sequence:CCGGCAGGAGAATGTGTTGGTCATTCTCGAGAATGACCAACACATTCTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-1350s1c1
Sequence:CCGGCGGTTGTAAAGTGGAGTCCATCTCGAGATGGACTCCACTTTACAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-478s1c1
Sequence:CCGGAGAGCGATGATCTTTAACTTTCTCGAGAAAGTTAAAGATCATCGCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-1409s1c1
Sequence:CCGGGACCTCAGAATGTAGACATATCTCGAGATATGTCTACATTCTGAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-924s1c1
Sequence:CCGGCCAGTTCATCAGTGACCAGAACTCGAGTTCTGGTCACTGATGAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173019
PFKFB4 MISSION shRNA Lentiviral Transduction Particles
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-527s21c1
Sequence:GTACCGGGAGCGATGATCTTTAACTTTGCTCGAGCAAAGTTAAAGATCATCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-1113s21c1
Sequence:GTACCGGGGAAATGACCTACGAAGAAATCTCGAGATTTCTTCGTAGGTCATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-1458s21c1
Sequence:GTACCGGACCTCAGAATGTAGACATATCCTCGAGGATATGTCTACATTCTGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173019.5-1262s21c1
Sequence:GTACCGGAGGAGAATGTGTTGGTCATTTCTCGAGAAATGACCAACACATTCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173019.5-1776s21c1
Sequence:CCGGCATGACGTTTGCAACCTTAAACTCGAGTTTAAGGTTGCAAACGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-1213s1c1
Sequence:CCGGCAGGAGAATGTGTTGGTCATTCTCGAGAATGACCAACACATTCTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-1350s1c1
Sequence:CCGGCGGTTGTAAAGTGGAGTCCATCTCGAGATGGACTCCACTTTACAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-478s1c1
Sequence:CCGGAGAGCGATGATCTTTAACTTTCTCGAGAAAGTTAAAGATCATCGCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-1409s1c1
Sequence:CCGGGACCTCAGAATGTAGACATATCTCGAGATATGTCTACATTCTGAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173019.2-924s1c1
Sequence:CCGGCCAGTTCATCAGTGACCAGAACTCGAGTTCTGGTCACTGATGAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)