EMAIL THIS PAGE TO A FRIEND

PFKM

phosphofructokinase, muscle

70 Gene Product Result for
Synonyms: GSD7 PFK-1 PFK1 PFKA PFKX
UniProtKB ID: P08237, J3KNX3, Q16814, Q16815, Q6ZTT1
Gene ID:
Human(5213) Summary: Three phosphofructokinase isozymes exist in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Tetramer composition varies depending on tissue type. This gene encodes the muscle-type isozyme. Mutations in this gene have been associated with glycogen storage disease type VII, also known as Tarui disease. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
Mouse(18642) phosphofructokinase, muscle
Rat(65152) phosphofructokinase, muscle
naked mole-rat(101705614) phosphofructokinase, muscle
Domestic Rabbit(100345647) phosphofructokinase, muscle
domestic guinea pig(100733625) phosphofructokinase, muscle
cow(506544) phosphofructokinase, muscle
chicken(374064) phosphofructokinase, muscle
domestic cat(101088852) phosphofructokinase, muscle
Horse(100034116) phosphofructokinase, muscle
dog(403849) phosphofructokinase, muscle
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000289 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000289 Rosetta Predictions human pricing
NM_031715 Rosetta Predictions rat pricing
NM_021514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049754 predicted 2263
2 SASI_Hs01_00049755 predicted 2435
3 SASI_Hs01_00049756 predicted 1867
4 SASI_Hs01_00049757 predicted 1601
5 SASI_Hs01_00049758 predicted 1555
6 SASI_Hs01_00049759 predicted 2498
7 SASI_Hs01_00049760 predicted 1014
8 SASI_Hs01_00049761 predicted 1030
9 SASI_Hs01_00049762 predicted 2556
10 SASI_Hs01_00049763 predicted 2425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085232 predicted 432
2 SASI_Rn01_00085233 predicted 798
3 SASI_Rn01_00085234 predicted 2332
4 SASI_Rn01_00085235 predicted 1182
5 SASI_Rn01_00085236 predicted 1464
6 SASI_Rn01_00085237 predicted 2283
7 SASI_Rn01_00085238 predicted 1597
8 SASI_Rn01_00085239 predicted 1475
9 SASI_Rn01_00085240 predicted 1418
10 SASI_Rn02_00265084 predicted 452
11 SASI_Rn01_00085241 predicted 2109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122523 predicted 2001
2 SASI_Mm01_00122524 predicted 1602
3 SASI_Mm01_00122525 predicted 1188
4 SASI_Mm01_00122526 predicted 2431
5 SASI_Mm01_00122527 predicted 2343
6 SASI_Mm01_00122528 predicted 1752
7 SASI_Mm01_00122529 predicted 919
8 SASI_Mm01_00122530 predicted 1938
9 SASI_Mm01_00122531 predicted 1473
10 SASI_Mm01_00122532 predicted 2291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021514
VALIDATED
PFKM MISSION shRNA Bacterial Glycerol Stock
phosphofructokinase, muscle
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021514.3-1123s21c1
Sequence:CCGGGCTATGGATGAGAAGAGATTTCTCGAGAAATCTCTTCTCATCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-2091s1c1
Sequence:CCGGTGCCACTAAGATGGGTGCTAACTCGAGTTAGCACCCATCTTAGTGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-1147s1c1
Sequence:CCGGGCTATGGATGAGAAGAGATTTCTCGAGAAATCTCTTCTCATCCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-2645s1c1
Sequence:CCGGCTCTAGTGCTACGGCTAGATTCTCGAGAATCTAGCCGTAGCACTAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-832s1c1
Sequence:CCGGCGTCTCAACATCATCATTGTTCTCGAGAACAATGATGATGTTGAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-2364s1c1
Sequence:CCGGCCTGGAGCACATTTCAAGGAACTCGAGTTCCTTGAAATGTGCTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021514.3-2067s21c1
Sequence:CCGGTGCCACTAAGATGGGTGCTAACTCGAGTTAGCACCCATCTTAGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021514.3-2621s21c1
Sequence:CCGGCTCTAGTGCTACGGCTAGATTCTCGAGAATCTAGCCGTAGCACTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021514.3-2340s21c1
Sequence:CCGGCCTGGAGCACATTTCAAGGAACTCGAGTTCCTTGAAATGTGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021514
VALIDATED
PFKM MISSION shRNA shRNA Plasmid DNA
phosphofructokinase, muscle
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021514.3-1123s21c1
Sequence:CCGGGCTATGGATGAGAAGAGATTTCTCGAGAAATCTCTTCTCATCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-2091s1c1
Sequence:CCGGTGCCACTAAGATGGGTGCTAACTCGAGTTAGCACCCATCTTAGTGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-1147s1c1
Sequence:CCGGGCTATGGATGAGAAGAGATTTCTCGAGAAATCTCTTCTCATCCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-2645s1c1
Sequence:CCGGCTCTAGTGCTACGGCTAGATTCTCGAGAATCTAGCCGTAGCACTAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-832s1c1
Sequence:CCGGCGTCTCAACATCATCATTGTTCTCGAGAACAATGATGATGTTGAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-2364s1c1
Sequence:CCGGCCTGGAGCACATTTCAAGGAACTCGAGTTCCTTGAAATGTGCTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021514.3-2067s21c1
Sequence:CCGGTGCCACTAAGATGGGTGCTAACTCGAGTTAGCACCCATCTTAGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021514.3-2621s21c1
Sequence:CCGGCTCTAGTGCTACGGCTAGATTCTCGAGAATCTAGCCGTAGCACTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021514.3-2340s21c1
Sequence:CCGGCCTGGAGCACATTTCAAGGAACTCGAGTTCCTTGAAATGTGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021514
VALIDATED
PFKM MISSION shRNA Lentiviral Transduction Particles
phosphofructokinase, muscle
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021514.3-1123s21c1
Sequence:CCGGGCTATGGATGAGAAGAGATTTCTCGAGAAATCTCTTCTCATCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-2091s1c1
Sequence:CCGGTGCCACTAAGATGGGTGCTAACTCGAGTTAGCACCCATCTTAGTGGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-1147s1c1
Sequence:CCGGGCTATGGATGAGAAGAGATTTCTCGAGAAATCTCTTCTCATCCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-2645s1c1
Sequence:CCGGCTCTAGTGCTACGGCTAGATTCTCGAGAATCTAGCCGTAGCACTAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-832s1c1
Sequence:CCGGCGTCTCAACATCATCATTGTTCTCGAGAACAATGATGATGTTGAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021514.2-2364s1c1
Sequence:CCGGCCTGGAGCACATTTCAAGGAACTCGAGTTCCTTGAAATGTGCTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021514.3-2067s21c1
Sequence:CCGGTGCCACTAAGATGGGTGCTAACTCGAGTTAGCACCCATCTTAGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021514.3-2621s21c1
Sequence:CCGGCTCTAGTGCTACGGCTAGATTCTCGAGAATCTAGCCGTAGCACTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021514.3-2340s21c1
Sequence:CCGGCCTGGAGCACATTTCAAGGAACTCGAGTTCCTTGAAATGTGCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000289
VALIDATED
PFKM MISSION shRNA Bacterial Glycerol Stock
phosphofructokinase, muscle
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-1708s1c1
Sequence:UNK
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-1571s1c1
Sequence:CCGGGCATCCCATTTGTGGTCATTCCTCGAGGAATGACCACAAATGGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-1649s1c1
Sequence:CCGGCACTCAATACTATCTGCACAACTCGAGTTGTGCAGATAGTATTGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-1883s1c1
Sequence:CCGGGCTTGGTGTTAAGGAATGAAACTCGAGTTTCATTCCTTAACACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-429s1c1
Sequence:CCGGCCTCCAGAAAGCAGGTAAGATCTCGAGATCTTACCTGCTTTCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-565s1c1
Sequence:CCGGCGGATCATGGAAATTGTAGATCTCGAGATCTACAATTTCCATGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-60s1c1
Sequence:CCGGCAAAGCCATTGCTGTCTTAACCTCGAGGTTAAGACAGCAATGGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-231s1c1
Sequence:CCGGCGTTTCGATGATGCTTCAGCTCTCGAGAGCTGAAGCATCATCGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-439s1c1
Sequence:CCGGGCAGGTAAGATCACAGATGAGCTCGAGCTCATCTGTGATCTTACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000289.3-2476s1c1
Sequence:CCGGCTTGCAGCCATGACCAGTTCTCTCGAGAGAACTGGTCATGGCTGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000289
VALIDATED
PFKM MISSION shRNA shRNA Plasmid DNA
phosphofructokinase, muscle
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-1708s1c1
Sequence:UNK
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-1571s1c1
Sequence:CCGGGCATCCCATTTGTGGTCATTCCTCGAGGAATGACCACAAATGGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-1649s1c1
Sequence:CCGGCACTCAATACTATCTGCACAACTCGAGTTGTGCAGATAGTATTGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-1883s1c1
Sequence:CCGGGCTTGGTGTTAAGGAATGAAACTCGAGTTTCATTCCTTAACACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-429s1c1
Sequence:CCGGCCTCCAGAAAGCAGGTAAGATCTCGAGATCTTACCTGCTTTCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-565s1c1
Sequence:CCGGCGGATCATGGAAATTGTAGATCTCGAGATCTACAATTTCCATGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-60s1c1
Sequence:CCGGCAAAGCCATTGCTGTCTTAACCTCGAGGTTAAGACAGCAATGGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-231s1c1
Sequence:CCGGCGTTTCGATGATGCTTCAGCTCTCGAGAGCTGAAGCATCATCGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-439s1c1
Sequence:CCGGGCAGGTAAGATCACAGATGAGCTCGAGCTCATCTGTGATCTTACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000289.3-2476s1c1
Sequence:CCGGCTTGCAGCCATGACCAGTTCTCTCGAGAGAACTGGTCATGGCTGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000289
VALIDATED
PFKM MISSION shRNA Lentiviral Transduction Particles
phosphofructokinase, muscle
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-1708s1c1
Sequence:UNK
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-1571s1c1
Sequence:CCGGGCATCCCATTTGTGGTCATTCCTCGAGGAATGACCACAAATGGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-1649s1c1
Sequence:CCGGCACTCAATACTATCTGCACAACTCGAGTTGTGCAGATAGTATTGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-1883s1c1
Sequence:CCGGGCTTGGTGTTAAGGAATGAAACTCGAGTTTCATTCCTTAACACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-429s1c1
Sequence:CCGGCCTCCAGAAAGCAGGTAAGATCTCGAGATCTTACCTGCTTTCTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000289.3-565s1c1
Sequence:CCGGCGGATCATGGAAATTGTAGATCTCGAGATCTACAATTTCCATGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-60s1c1
Sequence:CCGGCAAAGCCATTGCTGTCTTAACCTCGAGGTTAAGACAGCAATGGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-231s1c1
Sequence:CCGGCGTTTCGATGATGCTTCAGCTCTCGAGAGCTGAAGCATCATCGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000289.3-439s1c1
Sequence:CCGGGCAGGTAAGATCACAGATGAGCTCGAGCTCATCTGTGATCTTACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000289.3-2476s1c1
Sequence:CCGGCTTGCAGCCATGACCAGTTCTCTCGAGAGAACTGGTCATGGCTGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)