EMAIL THIS PAGE TO A FRIEND

PFKP

phosphofructokinase, platelet

80 Gene Product Result for
Synonyms: PFK-C PFKF
UniProtKB ID: Q01813, B3KS15, Q5VSR7, Q5VSR8
Gene ID:
Human(5214) Summary: The PFKP gene encodes the platelet isoform of phosphofructokinase (PFK) (ATP:D-fructose-6-phosphate-1-phosphotransferase, EC 2.7.1.11). PFK catalyzes the irreversible conversion of fructose-6-phosphate to fructose-1,6-bisphosphate and is a key regulatory enzyme in glycolysis. The PFKP gene, which maps to chromosome 10p, is also expressed in fibroblasts. See also the muscle (PFKM; MIM 610681) and liver (PFKL; MIM 171860) isoforms of phosphofructokinase, which map to chromosomes 12q13 and 21q22, respectively. Vora (1981) [PubMed 6451249]
Mouse(56421) phosphofructokinase, platelet
Rat(60416) phosphofructokinase, platelet
chicken(428411) phosphofructokinase, platelet
dog(478019) phosphofructokinase, platelet
domestic cat(101097072) phosphofructokinase, platelet
Horse(100070818) phosphofructokinase, platelet
cow(507119) phosphofructokinase, platelet
sheep(101108592) phosphofructokinase, platelet
domestic guinea pig(100722738) phosphofructokinase, platelet
Domestic Rabbit(100009526) phosphofructokinase, platelet
naked mole-rat(101709405) phosphofructokinase, platelet
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502183 Anti-K6PP antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB1100366 Anti-PFKP (1-15) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100367 Anti-PFKP (770-784) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300130 Anti-PFKP (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300475 Anti-PFKP (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1400203 Anti-PFKP antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1401282 Anti-PFKP antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA018257 Anti-PFKP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA056484 Anti-PFKP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4100376 Monoclonal Anti-PFKP antibody produced in mouse clone PFKP-A322, culture supernatant human
western blot pricing
SAB4100407 Monoclonal Anti-PFKP antibody produced in mouse clone PFKP-B322, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002627 Rosetta Predictions human pricing
NM_206847 Rosetta Predictions rat pricing
NM_019703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186033 predicted 1015
2 SASI_Hs02_00334144 predicted 1529
3 SASI_Hs01_00186034 predicted 1242
4 SASI_Hs01_00186036 predicted 1654
5 SASI_Hs01_00186037 predicted 1937
6 SASI_Hs01_00186038 predicted 1210
7 SASI_Hs01_00186039 predicted 1254
8 SASI_Hs01_00186040 predicted 1226
9 SASI_Hs01_00186041 predicted 1376
10 SASI_Hs01_00186042 predicted 1153
11 SASI_Hs01_00186035 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031546 predicted 2366
2 SASI_Rn01_00031547 predicted 1577
3 SASI_Rn01_00031548 predicted 459
4 SASI_Rn01_00031549 predicted 815
5 SASI_Rn01_00031550 predicted 592
6 SASI_Rn01_00031551 predicted 1331
7 SASI_Rn01_00031552 predicted 2156
8 SASI_Rn01_00031553 predicted 1857
9 SASI_Rn01_00031554 predicted 1083
10 SASI_Rn01_00031555 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134840 predicted 1234
2 SASI_Mm01_00134841 predicted 609
3 SASI_Mm01_00134842 predicted 2319
4 SASI_Mm01_00134843 predicted 1532
5 SASI_Mm02_00324807 predicted 804
6 SASI_Mm01_00134844 predicted 1660
7 SASI_Mm01_00134845 predicted 1074
8 SASI_Mm01_00134846 predicted 367
9 SASI_Mm01_00134847 predicted 1944
10 SASI_Mm01_00134848 predicted 2292
11 SASI_Mm01_00134849 predicted 2212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002627
VALIDATED
PFKP MISSION shRNA Bacterial Glycerol Stock
phosphofructokinase, platelet
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-436s21c1
Sequence:CCGGGCCAACCTCTTCCGGAAGGAGCTCGAGCTCCTTCCGGAAGAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-1207s21c1
Sequence:CCGGCTGAACACCTACAAGCGACTTCTCGAGAAGTCGCTTGTAGGTGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002627.3-2462s1c1
Sequence:CCGGCAGCACTTTATGCACGTATTACTCGAGTAATACGTGCATAAAGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-510s1c1
Sequence:CCGGCGTGCAGAAGTACGCCTACCTCTCGAGAGGTAGGCGTACTTCTGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1829s1c1
Sequence:CCGGCCGGAGCTGATGCCGCATACACTCGAGTGTATGCGGCATCAGCTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002627.3-2171s1c1
Sequence:CCGGCCACCGATGATTCCATTTGTGCTCGAGCACAAATGGAATCATCGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1152s1c1
Sequence:CCGGCGAGAGGAGATTTCAAGATGCCTCGAGGCATCTTGAAATCTCCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-436s1c1
Sequence:CCGGGCCAACCTCTTCCGGAAGGAGCTCGAGCTCCTTCCGGAAGAGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1764s1c1
Sequence:CCGGCGTGTTCATCATCGAGACCATCTCGAGATGGTCTCGATGATGAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1207s1c1
Sequence:CCGGCTGAACACCTACAAGCGACTTCTCGAGAAGTCGCTTGTAGGTGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002627.3-1642s1c1
Sequence:CCGGCCCGCTACTGTGTCCAACAATCTCGAGATTGTTGGACACAGTAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1366s1c1
Sequence:CCGGCTCGCCATCTATGATGGCTTTCTCGAGAAAGCCATCATAGATGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-2238s1c1
Sequence:CCGGGCTGAAGAAGCAAACGGATTTCTCGAGAAATCCGTTTGCTTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-1366s21c1
Sequence:CCGGCTCGCCATCTATGATGGCTTTCTCGAGAAAGCCATCATAGATGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-1152s21c1
Sequence:CCGGCGAGAGGAGATTTCAAGATGCCTCGAGGCATCTTGAAATCTCCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-2238s21c1
Sequence:CCGGGCTGAAGAAGCAAACGGATTTCTCGAGAAATCCGTTTGCTTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002627
VALIDATED
PFKP MISSION shRNA shRNA Plasmid DNA
phosphofructokinase, platelet
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-436s21c1
Sequence:CCGGGCCAACCTCTTCCGGAAGGAGCTCGAGCTCCTTCCGGAAGAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-1207s21c1
Sequence:CCGGCTGAACACCTACAAGCGACTTCTCGAGAAGTCGCTTGTAGGTGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002627.3-2462s1c1
Sequence:CCGGCAGCACTTTATGCACGTATTACTCGAGTAATACGTGCATAAAGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-510s1c1
Sequence:CCGGCGTGCAGAAGTACGCCTACCTCTCGAGAGGTAGGCGTACTTCTGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1829s1c1
Sequence:CCGGCCGGAGCTGATGCCGCATACACTCGAGTGTATGCGGCATCAGCTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002627.3-2171s1c1
Sequence:CCGGCCACCGATGATTCCATTTGTGCTCGAGCACAAATGGAATCATCGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1152s1c1
Sequence:CCGGCGAGAGGAGATTTCAAGATGCCTCGAGGCATCTTGAAATCTCCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-436s1c1
Sequence:CCGGGCCAACCTCTTCCGGAAGGAGCTCGAGCTCCTTCCGGAAGAGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1764s1c1
Sequence:CCGGCGTGTTCATCATCGAGACCATCTCGAGATGGTCTCGATGATGAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1207s1c1
Sequence:CCGGCTGAACACCTACAAGCGACTTCTCGAGAAGTCGCTTGTAGGTGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002627.3-1642s1c1
Sequence:CCGGCCCGCTACTGTGTCCAACAATCTCGAGATTGTTGGACACAGTAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1366s1c1
Sequence:CCGGCTCGCCATCTATGATGGCTTTCTCGAGAAAGCCATCATAGATGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-2238s1c1
Sequence:CCGGGCTGAAGAAGCAAACGGATTTCTCGAGAAATCCGTTTGCTTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-1366s21c1
Sequence:CCGGCTCGCCATCTATGATGGCTTTCTCGAGAAAGCCATCATAGATGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-1152s21c1
Sequence:CCGGCGAGAGGAGATTTCAAGATGCCTCGAGGCATCTTGAAATCTCCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-2238s21c1
Sequence:CCGGGCTGAAGAAGCAAACGGATTTCTCGAGAAATCCGTTTGCTTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002627
VALIDATED
PFKP MISSION shRNA Lentiviral Transduction Particles
phosphofructokinase, platelet
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-436s21c1
Sequence:CCGGGCCAACCTCTTCCGGAAGGAGCTCGAGCTCCTTCCGGAAGAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-1207s21c1
Sequence:CCGGCTGAACACCTACAAGCGACTTCTCGAGAAGTCGCTTGTAGGTGTTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002627.3-2462s1c1
Sequence:CCGGCAGCACTTTATGCACGTATTACTCGAGTAATACGTGCATAAAGTGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-510s1c1
Sequence:CCGGCGTGCAGAAGTACGCCTACCTCTCGAGAGGTAGGCGTACTTCTGCACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1829s1c1
Sequence:CCGGCCGGAGCTGATGCCGCATACACTCGAGTGTATGCGGCATCAGCTCCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002627.3-2171s1c1
Sequence:CCGGCCACCGATGATTCCATTTGTGCTCGAGCACAAATGGAATCATCGGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1152s1c1
Sequence:CCGGCGAGAGGAGATTTCAAGATGCCTCGAGGCATCTTGAAATCTCCTCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-436s1c1
Sequence:CCGGGCCAACCTCTTCCGGAAGGAGCTCGAGCTCCTTCCGGAAGAGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1764s1c1
Sequence:CCGGCGTGTTCATCATCGAGACCATCTCGAGATGGTCTCGATGATGAACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1207s1c1
Sequence:CCGGCTGAACACCTACAAGCGACTTCTCGAGAAGTCGCTTGTAGGTGTTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002627.3-1642s1c1
Sequence:CCGGCCCGCTACTGTGTCCAACAATCTCGAGATTGTTGGACACAGTAGCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-1366s1c1
Sequence:CCGGCTCGCCATCTATGATGGCTTTCTCGAGAAAGCCATCATAGATGGCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002627.3-2238s1c1
Sequence:CCGGGCTGAAGAAGCAAACGGATTTCTCGAGAAATCCGTTTGCTTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-1366s21c1
Sequence:CCGGCTCGCCATCTATGATGGCTTTCTCGAGAAAGCCATCATAGATGGCGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-1152s21c1
Sequence:CCGGCGAGAGGAGATTTCAAGATGCCTCGAGGCATCTTGAAATCTCCTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002627.3-2238s21c1
Sequence:CCGGGCTGAAGAAGCAAACGGATTTCTCGAGAAATCCGTTTGCTTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019703
VALIDATED
PFKP MISSION shRNA Bacterial Glycerol Stock
phosphofructokinase, platelet
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-1955s21c1
Sequence:CCGGACGAAAGCTGCAGTGTAAATTCTCGAGAATTTACACTGCAGCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-489s21c1
Sequence:CCGGTCGGAATGGTGATATCGATAACTCGAGTTATCGATATCACCATTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-2505s21c1
Sequence:CCGGTGACGGAGTCAGCAGTAATAACTCGAGTTATTACTGCTGACTCCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-1723s21c1
Sequence:CCGGGACACGTGCGACCGCATTAAACTCGAGTTTAATGCGGTCGCACGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-1866s21c1
Sequence:CCGGGCCATTTGATATCGGAGATTTCTCGAGAAATCTCCGATATCAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019703.2-2339s1c1
Sequence:CCGGGCGAGCTATGACATGTCTGATCTCGAGATCAGACATGTCATAGCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019703.2-520s1c1
Sequence:CCGGGCAGAAGTATTCCTACCTCAACTCGAGTTGAGGTAGGAATACTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019703.2-3374s1c1
Sequence:CCGGGCTCTGCTAAACTCTGCATTTCTCGAGAAATGCAGAGTTTAGCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019703.2-1376s1c1
Sequence:CCGGGCAATCTATGACGGCTTTGAACTCGAGTTCAAAGCCGTCATAGATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019703.2-1867s1c1
Sequence:CCGGGCCATTTGATATCGGAGATTTCTCGAGAAATCTCCGATATCAAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019703
VALIDATED
PFKP MISSION shRNA shRNA Plasmid DNA
phosphofructokinase, platelet
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-1955s21c1
Sequence:CCGGACGAAAGCTGCAGTGTAAATTCTCGAGAATTTACACTGCAGCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-489s21c1
Sequence:CCGGTCGGAATGGTGATATCGATAACTCGAGTTATCGATATCACCATTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-2505s21c1
Sequence:CCGGTGACGGAGTCAGCAGTAATAACTCGAGTTATTACTGCTGACTCCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-1723s21c1
Sequence:CCGGGACACGTGCGACCGCATTAAACTCGAGTTTAATGCGGTCGCACGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-1866s21c1
Sequence:CCGGGCCATTTGATATCGGAGATTTCTCGAGAAATCTCCGATATCAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019703.2-2339s1c1
Sequence:CCGGGCGAGCTATGACATGTCTGATCTCGAGATCAGACATGTCATAGCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019703.2-520s1c1
Sequence:CCGGGCAGAAGTATTCCTACCTCAACTCGAGTTGAGGTAGGAATACTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019703.2-3374s1c1
Sequence:CCGGGCTCTGCTAAACTCTGCATTTCTCGAGAAATGCAGAGTTTAGCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019703.2-1376s1c1
Sequence:CCGGGCAATCTATGACGGCTTTGAACTCGAGTTCAAAGCCGTCATAGATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019703.2-1867s1c1
Sequence:CCGGGCCATTTGATATCGGAGATTTCTCGAGAAATCTCCGATATCAAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019703
VALIDATED
PFKP MISSION shRNA Lentiviral Transduction Particles
phosphofructokinase, platelet
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-1955s21c1
Sequence:CCGGACGAAAGCTGCAGTGTAAATTCTCGAGAATTTACACTGCAGCTTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-489s21c1
Sequence:CCGGTCGGAATGGTGATATCGATAACTCGAGTTATCGATATCACCATTCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-2505s21c1
Sequence:CCGGTGACGGAGTCAGCAGTAATAACTCGAGTTATTACTGCTGACTCCGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-1723s21c1
Sequence:CCGGGACACGTGCGACCGCATTAAACTCGAGTTTAATGCGGTCGCACGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019703.3-1866s21c1
Sequence:CCGGGCCATTTGATATCGGAGATTTCTCGAGAAATCTCCGATATCAAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019703.2-2339s1c1
Sequence:CCGGGCGAGCTATGACATGTCTGATCTCGAGATCAGACATGTCATAGCTCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019703.2-520s1c1
Sequence:CCGGGCAGAAGTATTCCTACCTCAACTCGAGTTGAGGTAGGAATACTTCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019703.2-3374s1c1
Sequence:CCGGGCTCTGCTAAACTCTGCATTTCTCGAGAAATGCAGAGTTTAGCAGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019703.2-1376s1c1
Sequence:CCGGGCAATCTATGACGGCTTTGAACTCGAGTTCAAAGCCGTCATAGATTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019703.2-1867s1c1
Sequence:CCGGGCCATTTGATATCGGAGATTTCTCGAGAAATCTCCGATATCAAATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)