EMAIL THIS PAGE TO A FRIEND

PFN1

profilin 1

48 Gene Product Result for
Synonyms: ALS18
UniProtKB ID: P07737, Q53Y44
Gene ID:
Human(5216) Summary: This gene encodes a member of the profilin family of small actin-binding proteins. The encoded protein plays an important role in actin dynamics by regulating actin polymerization in response to extracellular signals. Deletion of this gene is associated with Miller-Dieker syndrome, and the encoded protein may also play a role in Huntington disease. Multiple pseudogenes of this gene are located on chromosome 1. [provided by RefSeq, Jul 2012]
Mouse(18643) profilin 1
Rat(64303) profilin 1
Zebrafish(799355) profilin 1
cow(513895) profilin 1
sheep(101109371) profilin 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005022 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005022 Rosetta Predictions human pricing
NM_022511 Rosetta Predictions rat pricing
NM_011072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225745 predicted 381
2 SASI_Hs01_00225746 predicted 386
3 SASI_Hs01_00225747 predicted 490
4 SASI_Hs01_00225748 predicted 290
5 SASI_Hs01_00225749 predicted 488
6 SASI_Hs01_00225750 predicted 494
7 SASI_Hs01_00225751 predicted 434
8 SASI_Hs01_00225752 predicted 445
9 SASI_Hs01_00225753 predicted 483
10 SASI_Hs01_00225754 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056824 predicted 468
2 SASI_Rn01_00056825 predicted 365
3 SASI_Rn01_00056826 predicted 439
4 SASI_Rn02_00263248 predicted 462
5 SASI_Rn01_00056827 predicted 462
6 SASI_Rn01_00056828 predicted 485
7 SASI_Rn01_00056829 predicted 466
8 SASI_Rn01_00056830 predicted 474
9 SASI_Rn01_00056831 predicted 477
10 SASI_Rn01_00056832 predicted 433
11 SASI_Rn01_00056833 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037773 predicted 262
2 SASI_Mm01_00037774 predicted 549
3 SASI_Mm01_00037775 predicted 397
4 SASI_Mm02_00319839 predicted 261
5 SASI_Mm02_00319840 predicted 459
6 SASI_Mm01_00037781 predicted 287
7 SASI_Mm02_00319841 predicted 255
8 SASI_Mm01_00037772 predicted 304
9 SASI_Mm01_00037776 predicted 472
10 SASI_Mm01_00037777 predicted 401
11 SASI_Mm01_00037778 predicted 532
12 SASI_Mm01_00037779 predicted 504
13 SASI_Mm01_00037780 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011072
VALIDATED
PFN1 MISSION shRNA Bacterial Glycerol Stock
profilin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-297s1c1
Sequence:CCGGGTTGGTGTCCTGGTAGGCAAACTCGAGTTTGCCTACCAGGACACCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-633s1c1
Sequence:CCGGCCATACACACACATACCATTACTCGAGTAATGGTATGTGTGTGTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-515s1c1
Sequence:CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-445s1c1
Sequence:CCGGCCACCTTCAATGTCACTGTCACTCGAGTGACAGTGACATTGAAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-409s1c1
Sequence:CCGGCAATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011072.3-296s21c1
Sequence:CCGGGTTGGTGTCCTGGTAGGCAAACTCGAGTTTGCCTACCAGGACACCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011072.3-408s21c1
Sequence:CCGGCAATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011072.3-514s21c1
Sequence:CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011072.3-632s21c1
Sequence:CCGGCCATACACACACATACCATTACTCGAGTAATGGTATGTGTGTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011072
VALIDATED
PFN1 MISSION shRNA shRNA Plasmid DNA
profilin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-297s1c1
Sequence:CCGGGTTGGTGTCCTGGTAGGCAAACTCGAGTTTGCCTACCAGGACACCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-633s1c1
Sequence:CCGGCCATACACACACATACCATTACTCGAGTAATGGTATGTGTGTGTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-515s1c1
Sequence:CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-445s1c1
Sequence:CCGGCCACCTTCAATGTCACTGTCACTCGAGTGACAGTGACATTGAAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-409s1c1
Sequence:CCGGCAATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011072.3-296s21c1
Sequence:CCGGGTTGGTGTCCTGGTAGGCAAACTCGAGTTTGCCTACCAGGACACCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011072.3-408s21c1
Sequence:CCGGCAATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011072.3-514s21c1
Sequence:CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011072.3-632s21c1
Sequence:CCGGCCATACACACACATACCATTACTCGAGTAATGGTATGTGTGTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011072
VALIDATED
PFN1 MISSION shRNA Lentiviral Transduction Particles
profilin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-297s1c1
Sequence:CCGGGTTGGTGTCCTGGTAGGCAAACTCGAGTTTGCCTACCAGGACACCAACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-633s1c1
Sequence:CCGGCCATACACACACATACCATTACTCGAGTAATGGTATGTGTGTGTATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-515s1c1
Sequence:CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-445s1c1
Sequence:CCGGCCACCTTCAATGTCACTGTCACTCGAGTGACAGTGACATTGAAGGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011072.2-409s1c1
Sequence:CCGGCAATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011072.3-296s21c1
Sequence:CCGGGTTGGTGTCCTGGTAGGCAAACTCGAGTTTGCCTACCAGGACACCAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011072.3-408s21c1
Sequence:CCGGCAATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011072.3-514s21c1
Sequence:CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011072.3-632s21c1
Sequence:CCGGCCATACACACACATACCATTACTCGAGTAATGGTATGTGTGTGTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005022
VALIDATED
PFN1 MISSION shRNA Bacterial Glycerol Stock
profilin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005022.2-513s1c1
Sequence:CCGGAGAAATGTTATGAAATGGCCTCTCGAGAGGCCATTTCATAACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005022.2-314s1c1
Sequence:CCGGTACGTGAATGGGCTGACACTTCTCGAGAAGTGTCAGCCCATTCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005022.2-390s1c1
Sequence:CCGGGCATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005022.2-467s1c1
Sequence:CCGGGTCCTGCTGATGGGCAAAGAACTCGAGTTCTTTGCCCATCAGCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-314s21c1
Sequence:CCGGTACGTGAATGGGCTGACACTTCTCGAGAAGTGTCAGCCCATTCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-491s21c1
Sequence:CCGGGTCCACGGTGGTTTGATCAACCTCGAGGTTGATCAAACCACCGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-390s21c1
Sequence:CCGGGCATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-467s21c1
Sequence:CCGGGTCCTGCTGATGGGCAAAGAACTCGAGTTCTTTGCCCATCAGCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005022
VALIDATED
PFN1 MISSION shRNA shRNA Plasmid DNA
profilin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005022.2-513s1c1
Sequence:CCGGAGAAATGTTATGAAATGGCCTCTCGAGAGGCCATTTCATAACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005022.2-314s1c1
Sequence:CCGGTACGTGAATGGGCTGACACTTCTCGAGAAGTGTCAGCCCATTCACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005022.2-390s1c1
Sequence:CCGGGCATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005022.2-467s1c1
Sequence:CCGGGTCCTGCTGATGGGCAAAGAACTCGAGTTCTTTGCCCATCAGCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-314s21c1
Sequence:CCGGTACGTGAATGGGCTGACACTTCTCGAGAAGTGTCAGCCCATTCACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-491s21c1
Sequence:CCGGGTCCACGGTGGTTTGATCAACCTCGAGGTTGATCAAACCACCGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-390s21c1
Sequence:CCGGGCATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-467s21c1
Sequence:CCGGGTCCTGCTGATGGGCAAAGAACTCGAGTTCTTTGCCCATCAGCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005022
VALIDATED
PFN1 MISSION shRNA Lentiviral Transduction Particles
profilin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005022.2-513s1c1
Sequence:CCGGAGAAATGTTATGAAATGGCCTCTCGAGAGGCCATTTCATAACATTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005022.2-314s1c1
Sequence:CCGGTACGTGAATGGGCTGACACTTCTCGAGAAGTGTCAGCCCATTCACGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005022.2-390s1c1
Sequence:CCGGGCATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005022.2-467s1c1
Sequence:CCGGGTCCTGCTGATGGGCAAAGAACTCGAGTTCTTTGCCCATCAGCAGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-314s21c1
Sequence:CCGGTACGTGAATGGGCTGACACTTCTCGAGAAGTGTCAGCCCATTCACGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-491s21c1
Sequence:CCGGGTCCACGGTGGTTTGATCAACCTCGAGGTTGATCAAACCACCGTGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-390s21c1
Sequence:CCGGGCATGGATCTTCGTACCAAGACTCGAGTCTTGGTACGAAGATCCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005022.2-467s21c1
Sequence:CCGGGTCCTGCTGATGGGCAAAGAACTCGAGTTCTTTGCCCATCAGCAGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)