EMAIL THIS PAGE TO A FRIEND

PFN2

profilin 2

208 Gene Product Result for
Synonyms: D3S1319E PFL
UniProtKB ID: P35080, B2R4C8, D3DNI4, Q4VBQ4, Q8WVF9, Q9HBK2
Gene ID:
Human(5217) Summary: The protein encoded by this gene is a ubiquitous actin monomer-binding protein belonging to the profilin family. It is thought to regulate actin polymerization in response to extracellular signals. There are two alternatively spliced transcript variants encoding different isoforms described for this gene. [provided by RefSeq, Jul 2008]
Mouse(18645) profilin 2
Rat(81531) profilin 2
Thale Cress(829056) profilin 2
Zebrafish(394235) profilin 2
chicken(771904) profilin 2
cow(539034) profilin 2
sheep(101102531) profilin 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053024 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002628 Rosetta Predictions human pricing
NM_053024 Rosetta Predictions human pricing
NM_030873 Rosetta Predictions rat pricing
NM_019410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056020 predicted 685
2 SASI_Hs01_00056022 predicted 638
3 SASI_Hs02_00334145 predicted 717
4 SASI_Hs01_00056024 predicted 646
5 SASI_Hs01_00056026 predicted 671
6 SASI_Hs01_00056025 predicted 684
7 SASI_Hs02_00334146 predicted 626
8 SASI_Hs02_00334147 predicted 684
9 SASI_Hs02_00334148 predicted 696
10 SASI_Hs01_00056021 predicted 760
11 SASI_Hs01_00056023 predicted 785
12 SASI_Hs01_00056027 predicted 323
13 SASI_Hs01_00056028 predicted 226
14 SASI_Hs01_00056029 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139789 predicted 1007
2 SASI_Hs01_00139790 predicted 962
3 SASI_Hs01_00139791 predicted 967
4 SASI_Hs01_00139793 predicted 991
5 SASI_Hs01_00139792 predicted 1007
6 SASI_Hs02_00361844 predicted 944
7 SASI_Hs02_00361845 predicted 1010
8 SASI_Hs02_00361846 predicted 1020
9 SASI_Hs01_00139794 predicted 620
10 SASI_Hs01_00139795 predicted 320
11 SASI_Hs01_00139796 predicted 217
12 SASI_Hs01_00139797 predicted 306
13 SASI_Hs01_00139798 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093599 predicted 695
2 SASI_Rn01_00093600 predicted 781
3 SASI_Rn01_00093601 predicted 747
4 SASI_Rn01_00093602 predicted 215
5 SASI_Rn01_00093603 predicted 244
6 SASI_Rn01_00093604 predicted 225
7 SASI_Rn01_00093606 predicted 865
8 SASI_Rn02_00264138 predicted 811
9 SASI_Rn01_00093607 predicted 505
10 SASI_Rn01_00093608 predicted 289
11 SASI_Rn01_00093605 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168092 predicted 738
2 SASI_Mm01_00168093 predicted 929
3 SASI_Mm01_00168094 predicted 837
4 SASI_Mm01_00168095 predicted 276
5 SASI_Mm01_00168096 predicted 276
6 SASI_Mm01_00168097 predicted 414
7 SASI_Mm01_00168098 predicted 256
8 SASI_Mm02_00324334 predicted 745
9 SASI_Mm01_00168099 predicted 899
10 SASI_Mm01_00168100 predicted 727
11 SASI_Mm01_00168091 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019410
VALIDATED
PFN2 MISSION shRNA Bacterial Glycerol Stock
profilin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-461s21c1
Sequence:CCGGCGGTTTGACTCTTGGAGCAAACTCGAGTTTGCTCCAAGAGTCAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-564s21c1
Sequence:CCGGCCAACATACAACGTTGCTGTTCTCGAGAACAGCAACGTTGTATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-187s1c1
Sequence:CCGGGCCAGTAGAAATAGATATGATCTCGAGATCATATCTATTTCTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-421s1c1
Sequence:CCGGCGGATTGAATAAGAAGGCATACTCGAGTATGCCTTCTTATTCAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-344s1c1
Sequence:CCGGCCAACATACAACGTTGCTGTTCTCGAGAACAGCAACGTTGTATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-241s1c1
Sequence:CCGGCGGTTTGACTCTTGGAGCAAACTCGAGTTTGCTCCAAGAGTCAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-291s1c1
Sequence:CCGGACGTTGATGGTGACTGCACAACTCGAGTTGTGCAGTCACCATCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-511s21c1
Sequence:CCGGACGTTGATGGTGACTGCACAACTCGAGTTGTGCAGTCACCATCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-641s21c1
Sequence:CCGGCGGATTGAATAAGAAGGCATACTCGAGTATGCCTTCTTATTCAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019410
VALIDATED
PFN2 MISSION shRNA shRNA Plasmid DNA
profilin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-461s21c1
Sequence:CCGGCGGTTTGACTCTTGGAGCAAACTCGAGTTTGCTCCAAGAGTCAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-564s21c1
Sequence:CCGGCCAACATACAACGTTGCTGTTCTCGAGAACAGCAACGTTGTATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-187s1c1
Sequence:CCGGGCCAGTAGAAATAGATATGATCTCGAGATCATATCTATTTCTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-421s1c1
Sequence:CCGGCGGATTGAATAAGAAGGCATACTCGAGTATGCCTTCTTATTCAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-344s1c1
Sequence:CCGGCCAACATACAACGTTGCTGTTCTCGAGAACAGCAACGTTGTATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-241s1c1
Sequence:CCGGCGGTTTGACTCTTGGAGCAAACTCGAGTTTGCTCCAAGAGTCAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-291s1c1
Sequence:CCGGACGTTGATGGTGACTGCACAACTCGAGTTGTGCAGTCACCATCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-511s21c1
Sequence:CCGGACGTTGATGGTGACTGCACAACTCGAGTTGTGCAGTCACCATCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-641s21c1
Sequence:CCGGCGGATTGAATAAGAAGGCATACTCGAGTATGCCTTCTTATTCAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019410
VALIDATED
PFN2 MISSION shRNA Lentiviral Transduction Particles
profilin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-461s21c1
Sequence:CCGGCGGTTTGACTCTTGGAGCAAACTCGAGTTTGCTCCAAGAGTCAAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-564s21c1
Sequence:CCGGCCAACATACAACGTTGCTGTTCTCGAGAACAGCAACGTTGTATGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-187s1c1
Sequence:CCGGGCCAGTAGAAATAGATATGATCTCGAGATCATATCTATTTCTACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-421s1c1
Sequence:CCGGCGGATTGAATAAGAAGGCATACTCGAGTATGCCTTCTTATTCAATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-344s1c1
Sequence:CCGGCCAACATACAACGTTGCTGTTCTCGAGAACAGCAACGTTGTATGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-241s1c1
Sequence:CCGGCGGTTTGACTCTTGGAGCAAACTCGAGTTTGCTCCAAGAGTCAAACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019410.2-291s1c1
Sequence:CCGGACGTTGATGGTGACTGCACAACTCGAGTTGTGCAGTCACCATCAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-511s21c1
Sequence:CCGGACGTTGATGGTGACTGCACAACTCGAGTTGTGCAGTCACCATCAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019410.3-641s21c1
Sequence:CCGGCGGATTGAATAAGAAGGCATACTCGAGTATGCCTTCTTATTCAATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053024
VALIDATED
PFN2 MISSION shRNA Bacterial Glycerol Stock
profilin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-299s21c1
Sequence:CCGGCGCGAAGAAATGCTCAGTGATCTCGAGATCACTGAGCATTTCTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-135s1c1
Sequence:CCGGCAGAGCATTACGCCAATAGAACTCGAGTTCTATTGGCGTAATGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-330s1c1
Sequence:CCGGGCTGGTAGAGTCTTGGTCTTTCTCGAGAAAGACCAAGACTCTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-215s1c1
Sequence:CCGGCGCGAAGAAATGCTCAGTGATCTCGAGATCACTGAGCATTTCTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-392s1c1
Sequence:CCGGGAAGGCATACTCAATGGCAAACTCGAGTTTGCCATTGAGTATGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053024.3-874s21c1
Sequence:CCGGCTTCATCAACAACCCTAATTACTCGAGTAATTAGGGTTGTTGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-476s21c1
Sequence:CCGGGAAGGCATACTCAATGGCAAACTCGAGTTTGCCATTGAGTATGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-351s21c1
Sequence:CCGGACAATGGACATCCGGACAAAGCTCGAGCTTTGTCCGGATGTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-179s1c1
Sequence:CCGGCCGGGAAGGTTTCTTTACCAACTCGAGTTGGTAAAGAAACCTTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-414s21c1
Sequence:CCGGGCTGGTAGAGTCTTGGTCTTTCTCGAGAAAGACCAAGACTCTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053024
VALIDATED
PFN2 MISSION shRNA shRNA Plasmid DNA
profilin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-299s21c1
Sequence:CCGGCGCGAAGAAATGCTCAGTGATCTCGAGATCACTGAGCATTTCTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-135s1c1
Sequence:CCGGCAGAGCATTACGCCAATAGAACTCGAGTTCTATTGGCGTAATGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-330s1c1
Sequence:CCGGGCTGGTAGAGTCTTGGTCTTTCTCGAGAAAGACCAAGACTCTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-215s1c1
Sequence:CCGGCGCGAAGAAATGCTCAGTGATCTCGAGATCACTGAGCATTTCTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-392s1c1
Sequence:CCGGGAAGGCATACTCAATGGCAAACTCGAGTTTGCCATTGAGTATGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053024.3-874s21c1
Sequence:CCGGCTTCATCAACAACCCTAATTACTCGAGTAATTAGGGTTGTTGATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-476s21c1
Sequence:CCGGGAAGGCATACTCAATGGCAAACTCGAGTTTGCCATTGAGTATGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-351s21c1
Sequence:CCGGACAATGGACATCCGGACAAAGCTCGAGCTTTGTCCGGATGTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-179s1c1
Sequence:CCGGCCGGGAAGGTTTCTTTACCAACTCGAGTTGGTAAAGAAACCTTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-414s21c1
Sequence:CCGGGCTGGTAGAGTCTTGGTCTTTCTCGAGAAAGACCAAGACTCTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053024
VALIDATED
PFN2 MISSION shRNA Lentiviral Transduction Particles
profilin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-299s21c1
Sequence:CCGGCGCGAAGAAATGCTCAGTGATCTCGAGATCACTGAGCATTTCTTCGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-135s1c1
Sequence:CCGGCAGAGCATTACGCCAATAGAACTCGAGTTCTATTGGCGTAATGCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-330s1c1
Sequence:CCGGGCTGGTAGAGTCTTGGTCTTTCTCGAGAAAGACCAAGACTCTACCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-215s1c1
Sequence:CCGGCGCGAAGAAATGCTCAGTGATCTCGAGATCACTGAGCATTTCTTCGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-392s1c1
Sequence:CCGGGAAGGCATACTCAATGGCAAACTCGAGTTTGCCATTGAGTATGCCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053024.3-874s21c1
Sequence:CCGGCTTCATCAACAACCCTAATTACTCGAGTAATTAGGGTTGTTGATGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-476s21c1
Sequence:CCGGGAAGGCATACTCAATGGCAAACTCGAGTTTGCCATTGAGTATGCCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-351s21c1
Sequence:CCGGACAATGGACATCCGGACAAAGCTCGAGCTTTGTCCGGATGTCCATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_053024.1-179s1c1
Sequence:CCGGCCGGGAAGGTTTCTTTACCAACTCGAGTTGGTAAAGAAACCTTCCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053024.3-414s21c1
Sequence:CCGGGCTGGTAGAGTCTTGGTCTTTCTCGAGAAAGACCAAGACTCTACCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)