EMAIL THIS PAGE TO A FRIEND

PFN3

profilin 3

43 Gene Product Result for
UniProtKB ID: P60673, A2RUL3
Gene ID:
Human(345456) Summary: The product of this gene belongs to the profilin family of proteins. This protein binds to actin and affects the structure of the cytoskeleton. It also may be involved in spermatogenesis. It is a single exon gene. [provided by RefSeq, Jul 2008]
Mouse(75477) profilin 3
Rat(685936) profilin 3
chicken(428564) profilin 3
dog(489091) profilin 3
cow(521379) profilin 3
sheep(101122691) profilin 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047234 Anti-PFN3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029886 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029886 Rosetta Predictions human pricing
NM_001109487 Rosetta Predictions rat pricing
NM_029303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307572 predicted 490
2 SASI_Hs02_00307573 predicted 495
3 SASI_Hs02_00307574 predicted 63
4 SASI_Hs02_00307575 predicted 493
5 SASI_Hs01_00231734 predicted 304
6 SASI_Hs01_00231735 predicted 419
7 SASI_Hs01_00231736 predicted 120
8 SASI_Hs01_00231737 predicted 115
9 SASI_Hs02_00307576 predicted 472
10 SASI_Hs01_00231739 predicted 294
11 SASI_Hs01_00231732 predicted 41
12 SASI_Hs01_00231733 predicted 213
13 SASI_Hs01_00231738 predicted 42
14 SASI_Hs01_00231740 predicted 384
15 SASI_Hs01_00231741 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248879 predicted 250
2 SASI_Rn02_00248880 predicted 202
3 SASI_Rn02_00248881 predicted 255
4 SASI_Rn02_00248882 predicted 283
5 SASI_Rn02_00248883 predicted 279
6 SASI_Rn02_00248884 predicted 204
7 SASI_Rn02_00248885 predicted 259
8 SASI_Rn02_00248886 predicted 254
9 SASI_Rn02_00248887 predicted 294
10 SASI_Rn02_00248888 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059786 predicted 300
2 SASI_Mm01_00059787 predicted 263
3 SASI_Mm01_00059788 predicted 272
4 SASI_Mm01_00059789 predicted 216
5 SASI_Mm01_00059790 predicted 315
6 SASI_Mm01_00059791 predicted 220
7 SASI_Mm01_00059792 predicted 304
8 SASI_Mm01_00059793 predicted 277
9 SASI_Mm01_00059794 predicted 226
10 SASI_Mm01_00059795 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029886
PFN3 MISSION shRNA Bacterial Glycerol Stock
profilin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-105s21c1
Sequence:CCGGGCGCATCGACGACGTGGCCATCTCGAGATGGCCACGTCGTCGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-134s21c1
Sequence:CCGGATGCGGACAACAGCTGCGTGTCTCGAGACACGCAGCTGTTGTCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-313s21c1
Sequence:CCGGGTGCTGGACGCACGCACCAAGCTCGAGCTTGGTGCGTGCGTCCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-374s21c1
Sequence:CCGGGCGCGCTCCTGGTGCTAATGGCTCGAGCCATTAGCACCAGGAGCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-123s21c1
Sequence:CCGGCATCGTGGGCCATGCGGACAACTCGAGTTGTCCGCATGGCCCACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029886
PFN3 MISSION shRNA shRNA Plasmid DNA
profilin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-105s21c1
Sequence:CCGGGCGCATCGACGACGTGGCCATCTCGAGATGGCCACGTCGTCGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-134s21c1
Sequence:CCGGATGCGGACAACAGCTGCGTGTCTCGAGACACGCAGCTGTTGTCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-313s21c1
Sequence:CCGGGTGCTGGACGCACGCACCAAGCTCGAGCTTGGTGCGTGCGTCCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-374s21c1
Sequence:CCGGGCGCGCTCCTGGTGCTAATGGCTCGAGCCATTAGCACCAGGAGCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-123s21c1
Sequence:CCGGCATCGTGGGCCATGCGGACAACTCGAGTTGTCCGCATGGCCCACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029886
PFN3 MISSION shRNA Lentiviral Transduction Particles
profilin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-105s21c1
Sequence:CCGGGCGCATCGACGACGTGGCCATCTCGAGATGGCCACGTCGTCGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-134s21c1
Sequence:CCGGATGCGGACAACAGCTGCGTGTCTCGAGACACGCAGCTGTTGTCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-313s21c1
Sequence:CCGGGTGCTGGACGCACGCACCAAGCTCGAGCTTGGTGCGTGCGTCCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-374s21c1
Sequence:CCGGGCGCGCTCCTGGTGCTAATGGCTCGAGCCATTAGCACCAGGAGCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029886.2-123s21c1
Sequence:CCGGCATCGTGGGCCATGCGGACAACTCGAGTTGTCCGCATGGCCCACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029303
PFN3 MISSION shRNA Bacterial Glycerol Stock
profilin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-268s1c1
Sequence:CCGGCTGCTGCGTTATCCGTGACTACTCGAGTAGTCACGGATAACGCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-103s1c1
Sequence:CCGGGCGGATCGATGACGTGGCTATCTCGAGATAGCCACGTCATCGATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-130s1c1
Sequence:CCGGCCACTCGGACAATCGCTGTGTCTCGAGACACAGCGATTGTCCGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-345s1c1
Sequence:CCGGGTGCAATCTGTGTGGGCCACACTCGAGTGTGGCCCACACAGATTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-138s1c1
Sequence:CCGGACAATCGCTGTGTGTGGGCATCTCGAGATGCCCACACACAGCGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029303
PFN3 MISSION shRNA shRNA Plasmid DNA
profilin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-268s1c1
Sequence:CCGGCTGCTGCGTTATCCGTGACTACTCGAGTAGTCACGGATAACGCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-103s1c1
Sequence:CCGGGCGGATCGATGACGTGGCTATCTCGAGATAGCCACGTCATCGATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-130s1c1
Sequence:CCGGCCACTCGGACAATCGCTGTGTCTCGAGACACAGCGATTGTCCGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-345s1c1
Sequence:CCGGGTGCAATCTGTGTGGGCCACACTCGAGTGTGGCCCACACAGATTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-138s1c1
Sequence:CCGGACAATCGCTGTGTGTGGGCATCTCGAGATGCCCACACACAGCGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029303
PFN3 MISSION shRNA Lentiviral Transduction Particles
profilin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-268s1c1
Sequence:CCGGCTGCTGCGTTATCCGTGACTACTCGAGTAGTCACGGATAACGCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-103s1c1
Sequence:CCGGGCGGATCGATGACGTGGCTATCTCGAGATAGCCACGTCATCGATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-130s1c1
Sequence:CCGGCCACTCGGACAATCGCTGTGTCTCGAGACACAGCGATTGTCCGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-345s1c1
Sequence:CCGGGTGCAATCTGTGTGGGCCACACTCGAGTGTGGCCCACACAGATTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029303.1-138s1c1
Sequence:CCGGACAATCGCTGTGTGTGGGCATCTCGAGATGCCCACACACAGCGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)