EMAIL THIS PAGE TO A FRIEND

PFN4

profilin family, member 4

70 Gene Product Result for
UniProtKB ID: Q8NHR9, Q53TL9
Gene ID:
Mouse(382562) profilin family, member 4
Rat(494222) profilin family, member 4
cow(508874) profilin family, member 4
sheep(101106504) profilin family, member 4
domestic guinea pig(100719338) profilin family, member 4
naked mole-rat(101709082) profilin family, member 4
chicken(769795) profilin family, member 4
domestic cat(101095411) profilin family, member 4
dog(610829) profilin family, member 4
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199346 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199346 Rosetta Predictions human pricing
NM_001009503 Rosetta Predictions rat pricing
NM_028376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209970 predicted 454
2 SASI_Hs01_00209971 predicted 356
3 SASI_Hs01_00209972 predicted 230
4 SASI_Hs02_00372788 predicted 392
5 SASI_Hs01_00209973 predicted 490
6 SASI_Hs01_00209974 predicted 430
7 SASI_Hs01_00209975 predicted 339
8 SASI_Hs01_00209976 predicted 309
9 SASI_Hs01_00209977 predicted 443
10 SASI_Hs01_00209978 predicted 317
11 SASI_Hs01_00209979 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068091 predicted 1476
2 SASI_Rn01_00068092 predicted 976
3 SASI_Rn01_00068093 predicted 1510
4 SASI_Rn01_00068094 predicted 1475
5 SASI_Rn01_00068095 predicted 896
6 SASI_Rn01_00068096 predicted 1235
7 SASI_Rn01_00068097 predicted 1201
8 SASI_Rn01_00068098 predicted 1006
9 SASI_Rn01_00068099 predicted 1262
10 SASI_Rn01_00068100 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063952 predicted 945
2 SASI_Mm01_00063953 predicted 858
3 SASI_Mm01_00063954 predicted 1039
4 SASI_Mm01_00063955 predicted 965
5 SASI_Mm01_00063956 predicted 863
6 SASI_Mm01_00063957 predicted 963
7 SASI_Mm01_00063958 predicted 908
8 SASI_Mm01_00063959 predicted 990
9 SASI_Mm01_00063960 predicted 912
10 SASI_Mm01_00063961 predicted 1079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028376
PFN4 MISSION shRNA Bacterial Glycerol Stock
profilin family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-1026s1c1
Sequence:CCGGCCATTATTAACGCGAAGGGAACTCGAGTTCCCTTCGCGTTAATAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-996s1c1
Sequence:CCGGCGAACACTTCTGAATGGATTTCTCGAGAAATCCATTCAGAAGTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-1062s1c1
Sequence:CCGGGAGAAGGATTACAAATGTGTTCTCGAGAACACATTTGTAATCCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-967s1c1
Sequence:CCGGCAGGATTTAGTGTAATGCCAACTCGAGTTGGCATTACACTAAATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-1150s1c1
Sequence:CCGGTGTATCTTGTGGTGGCAACTTCTCGAGAAGTTGCCACCACAAGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028376
PFN4 MISSION shRNA shRNA Plasmid DNA
profilin family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-1026s1c1
Sequence:CCGGCCATTATTAACGCGAAGGGAACTCGAGTTCCCTTCGCGTTAATAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-996s1c1
Sequence:CCGGCGAACACTTCTGAATGGATTTCTCGAGAAATCCATTCAGAAGTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-1062s1c1
Sequence:CCGGGAGAAGGATTACAAATGTGTTCTCGAGAACACATTTGTAATCCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-967s1c1
Sequence:CCGGCAGGATTTAGTGTAATGCCAACTCGAGTTGGCATTACACTAAATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-1150s1c1
Sequence:CCGGTGTATCTTGTGGTGGCAACTTCTCGAGAAGTTGCCACCACAAGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028376
PFN4 MISSION shRNA Lentiviral Transduction Particles
profilin family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-1026s1c1
Sequence:CCGGCCATTATTAACGCGAAGGGAACTCGAGTTCCCTTCGCGTTAATAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-996s1c1
Sequence:CCGGCGAACACTTCTGAATGGATTTCTCGAGAAATCCATTCAGAAGTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-1062s1c1
Sequence:CCGGGAGAAGGATTACAAATGTGTTCTCGAGAACACATTTGTAATCCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-967s1c1
Sequence:CCGGCAGGATTTAGTGTAATGCCAACTCGAGTTGGCATTACACTAAATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028376.1-1150s1c1
Sequence:CCGGTGTATCTTGTGGTGGCAACTTCTCGAGAAGTTGCCACCACAAGATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199346
PFN4 MISSION shRNA Bacterial Glycerol Stock
profilin family, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-353s1c1
Sequence:CCGGCCGAAGAGAAGGACTGTATTTCTCGAGAAATACAGTCCTTCTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-269s1c1
Sequence:CCGGGTGTGTAGCATCACCAGGTTTCTCGAGAAACCTGGTGATGCTACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-479s1c1
Sequence:CCGGAGCAACTTACACTGAGGGCATCTCGAGATGCCCTCAGTGTAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-312s1c1
Sequence:CCGGCGAACACTGGTGAATGGATTTCTCGAGAAATCCATTCACCAGTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199346.1-217s21c1
Sequence:CCGGGAACCAAGCATGTGGACAGTGCTCGAGCACTGTCCACATGCTTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199346.1-394s21c1
Sequence:CCGGGTGTCCGGGCAGATGAATATTCTCGAGAATATTCATCTGCCCGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199346.1-573s21c1
Sequence:CCGGAGAGGCCCATGAAAGACAATTCTCGAGAATTGTCTTTCATGGGCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199346
PFN4 MISSION shRNA shRNA Plasmid DNA
profilin family, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-353s1c1
Sequence:CCGGCCGAAGAGAAGGACTGTATTTCTCGAGAAATACAGTCCTTCTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-269s1c1
Sequence:CCGGGTGTGTAGCATCACCAGGTTTCTCGAGAAACCTGGTGATGCTACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-479s1c1
Sequence:CCGGAGCAACTTACACTGAGGGCATCTCGAGATGCCCTCAGTGTAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-312s1c1
Sequence:CCGGCGAACACTGGTGAATGGATTTCTCGAGAAATCCATTCACCAGTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199346.1-217s21c1
Sequence:CCGGGAACCAAGCATGTGGACAGTGCTCGAGCACTGTCCACATGCTTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199346.1-394s21c1
Sequence:CCGGGTGTCCGGGCAGATGAATATTCTCGAGAATATTCATCTGCCCGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199346.1-573s21c1
Sequence:CCGGAGAGGCCCATGAAAGACAATTCTCGAGAATTGTCTTTCATGGGCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199346
PFN4 MISSION shRNA Lentiviral Transduction Particles
profilin family, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-353s1c1
Sequence:CCGGCCGAAGAGAAGGACTGTATTTCTCGAGAAATACAGTCCTTCTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-269s1c1
Sequence:CCGGGTGTGTAGCATCACCAGGTTTCTCGAGAAACCTGGTGATGCTACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-479s1c1
Sequence:CCGGAGCAACTTACACTGAGGGCATCTCGAGATGCCCTCAGTGTAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199346.1-312s1c1
Sequence:CCGGCGAACACTGGTGAATGGATTTCTCGAGAAATCCATTCACCAGTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199346.1-217s21c1
Sequence:CCGGGAACCAAGCATGTGGACAGTGCTCGAGCACTGTCCACATGCTTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199346.1-394s21c1
Sequence:CCGGGTGTCCGGGCAGATGAATATTCTCGAGAATATTCATCTGCCCGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199346.1-573s21c1
Sequence:CCGGAGAGGCCCATGAAAGACAATTCTCGAGAATTGTCTTTCATGGGCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)