EMAIL THIS PAGE TO A FRIEND

PGA3

pepsinogen 3, group I (pepsinogen A)

52 Gene Product Result for
Synonyms: PGA4 PGA5
Species: Human PGA3(643834)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079807 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079807 Rosetta Predictions human pricing
XM_927605 Rosetta Predictions human pricing
XM_932192 Rosetta Predictions human pricing
XM_932200 Rosetta Predictions human pricing
XM_932206 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313740 predicted 437
2 SASI_Hs02_00313741 predicted 307
3 SASI_Hs02_00313742 predicted 508
4 SASI_Hs02_00313743 predicted 776
5 SASI_Hs02_00313744 predicted 1165
6 SASI_Hs02_00313745 predicted 687
7 SASI_Hs02_00313746 predicted 738
8 SASI_Hs02_00313747 predicted 526
9 SASI_Hs02_00313748 predicted 1170
10 SASI_Hs02_00313749 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267853 predicted 1282
2 SASI_Hs01_00267854 predicted 454
3 SASI_Hs01_00267855 predicted 1225
4 SASI_Hs01_00267856 predicted 522
5 SASI_Hs01_00267857 predicted 748
6 SASI_Hs01_00267858 predicted 794
7 SASI_Hs01_00267859 predicted 1179
8 SASI_Hs01_00267860 predicted 1319
9 SASI_Hs01_00267861 predicted 706
10 SASI_Hs01_00267862 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284627 predicted 1571
2 SASI_Hs01_00284628 predicted 748
3 SASI_Hs01_00284629 predicted 1519
4 SASI_Hs01_00284630 predicted 819
5 SASI_Hs01_00284631 predicted 1044
6 SASI_Hs01_00284632 predicted 1085
7 SASI_Hs01_00284633 predicted 1470
8 SASI_Hs01_00284634 predicted 1620
9 SASI_Hs01_00284635 predicted 990
10 SASI_Hs01_00284636 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268210 predicted 1455
2 SASI_Hs01_00268211 predicted 1232
3 SASI_Hs01_00268212 predicted 1357
4 SASI_Hs01_00268213 predicted 1170
5 SASI_Hs01_00268214 predicted 1332
6 SASI_Hs01_00268215 predicted 1372
7 SASI_Hs01_00268216 predicted 1936
8 SASI_Hs01_00268217 predicted 1971
9 SASI_Hs01_00268218 predicted 1407
10 SASI_Hs01_00268219 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277803 predicted 529
2 SASI_Hs01_00277804 predicted 471
3 SASI_Hs01_00277805 predicted 263
4 SASI_Hs01_00277806 predicted 405
5 SASI_Hs01_00277807 predicted 431
6 SASI_Hs01_00277808 predicted 574
7 SASI_Hs01_00277809 predicted 535
8 SASI_Hs01_00277810 predicted 470
9 SASI_Hs01_00277811 predicted 434
10 SASI_Hs01_00277812 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079807
PGA3 MISSION shRNA Bacterial Glycerol Stock
pepsinogen 3, group I (pepsinogen A)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-1151s21c1
Sequence:CCGGCTTCATCCGCCAGTACTTTACCTCGAGGTAAAGTACTGGCGGATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-741s21c1
Sequence:CCGGGGTGGCATTGACTCTTCTTACCTCGAGGTAAGAAGAGTCAATGCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-561s21c1
Sequence:CCGGCCTGGCTCCTTCCTGTATTATCTCGAGATAATACAGGAAGGAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-477s21c1
Sequence:CCGGATGACAGGCATCCTCGGATACCTCGAGGTATCCGAGGATGCCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-272s21c1
Sequence:CCGGTATGGAGTACTTCGGCACTATCTCGAGATAGTGCCGAAGTACTCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079807
PGA3 MISSION shRNA shRNA Plasmid DNA
pepsinogen 3, group I (pepsinogen A)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-1151s21c1
Sequence:CCGGCTTCATCCGCCAGTACTTTACCTCGAGGTAAAGTACTGGCGGATGAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000263041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-741s21c1
Sequence:CCGGGGTGGCATTGACTCTTCTTACCTCGAGGTAAGAAGAGTCAATGCCACCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000263040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-561s21c1
Sequence:CCGGCCTGGCTCCTTCCTGTATTATCTCGAGATAATACAGGAAGGAGCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000263043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-477s21c1
Sequence:CCGGATGACAGGCATCCTCGGATACCTCGAGGTATCCGAGGATGCCTGTCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000263042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-272s21c1
Sequence:CCGGTATGGAGTACTTCGGCACTATCTCGAGATAGTGCCGAAGTACTCCATATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079807
PGA3 MISSION shRNA Lentiviral Transduction Particles
pepsinogen 3, group I (pepsinogen A)
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000282483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-1151s21c1
Sequence:CCGGCTTCATCCGCCAGTACTTTACCTCGAGGTAAAGTACTGGCGGATGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-741s21c1
Sequence:CCGGGGTGGCATTGACTCTTCTTACCTCGAGGTAAGAAGAGTCAATGCCACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-561s21c1
Sequence:CCGGCCTGGCTCCTTCCTGTATTATCTCGAGATAATACAGGAAGGAGCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-477s21c1
Sequence:CCGGATGACAGGCATCCTCGGATACCTCGAGGTATCCGAGGATGCCTGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079807.1-272s21c1
Sequence:CCGGTATGGAGTACTTCGGCACTATCTCGAGATAGTGCCGAAGTACTCCATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)