EMAIL THIS PAGE TO A FRIEND

PGA4

pepsinogen 4, group I (pepsinogen A)

59 Gene Product Result for
Synonyms: PGA3 PGA5
Species: Human PGA4(643847), Thale Cress PGA4(839391)
UniProtKB ID: P0DJD7, A8K749, B7ZW75, P00790, Q7M4R0, Q8N1E3
Gene ID:
Thale Cress(839391) polygalacturonase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301035 Anti-PGA4 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1306173 ANTI-PGA4(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

Proteins

Product # Description Species Add to Cart
 
P1490 Pepsinogen I human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079808 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079808 Rosetta Predictions human pricing
XM_927631 Rosetta Predictions human pricing
XM_932210 Rosetta Predictions human pricing
XM_932213 Rosetta Predictions human pricing
XM_932219 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313750 predicted 437
2 SASI_Hs02_00313751 predicted 305
3 SASI_Hs02_00313752 predicted 514
4 SASI_Hs02_00313753 predicted 781
5 SASI_Hs02_00313754 predicted 1165
6 SASI_Hs02_00313755 predicted 689
7 SASI_Hs02_00313756 predicted 741
8 SASI_Hs02_00313757 predicted 525
9 SASI_Hs02_00313758 predicted 1163
10 SASI_Hs02_00313759 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300844 predicted 449
2 SASI_Hs01_00300845 predicted 306
3 SASI_Hs01_00300846 predicted 323
4 SASI_Hs01_00300847 predicted 410
5 SASI_Hs01_00300848 predicted 310
6 SASI_Hs01_00300849 predicted 304
7 SASI_Hs01_00300850 predicted 487
8 SASI_Hs01_00300851 predicted 420
9 SASI_Hs01_00300852 predicted 371
10 SASI_Hs01_00300853 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289672 predicted 740
2 SASI_Hs01_00289673 predicted 618
3 SASI_Hs01_00289674 predicted 697
4 SASI_Hs01_00289675 predicted 743
5 SASI_Hs01_00289676 predicted 701
6 SASI_Hs01_00289677 predicted 766
7 SASI_Hs01_00289678 predicted 776
8 SASI_Hs01_00289679 predicted 660
9 SASI_Hs01_00289680 predicted 792
10 SASI_Hs01_00289681 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300087 predicted 1452
2 SASI_Hs01_00300088 predicted 1237
3 SASI_Hs01_00300089 predicted 1349
4 SASI_Hs01_00300090 predicted 1170
5 SASI_Hs01_00300091 predicted 1327
6 SASI_Hs01_00300092 predicted 1932
7 SASI_Hs01_00300093 predicted 1973
8 SASI_Hs01_00300094 predicted 1896
9 SASI_Hs01_00300095 predicted 1881
10 SASI_Hs01_00300096 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275992 predicted 535
2 SASI_Hs01_00275993 predicted 476
3 SASI_Hs01_00275994 predicted 271
4 SASI_Hs01_00275995 predicted 400
5 SASI_Hs01_00275996 predicted 429
6 SASI_Hs01_00275997 predicted 581
7 SASI_Hs01_00275998 predicted 536
8 SASI_Hs01_00275999 predicted 469
9 SASI_Hs01_00276000 predicted 432
10 SASI_Hs01_00276001 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079808
PGA4 MISSION shRNA Bacterial Glycerol Stock
pepsinogen 4, group I (pepsinogen A)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-559s21c1
Sequence:CCGGACCTGGCTCCTTCCTGTATTACTCGAGTAATACAGGAAGGAGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-272s21c1
Sequence:CCGGATGGAGTACTTCGGCACTATCCTCGAGGATAGTGCCGAAGTACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-1008s21c1
Sequence:CCGGACATCGTCTTCACCATCAATGCTCGAGCATTGATGGTGAAGACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-1149s21c1
Sequence:CCGGTCTTCATCCGCCAGTACTTTACTCGAGTAAAGTACTGGCGGATGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-312s21c1
Sequence:CCGGAGGATTTCACCGTCGTCTTTGCTCGAGCAAAGACGACGGTGAAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079808
PGA4 MISSION shRNA shRNA Plasmid DNA
pepsinogen 4, group I (pepsinogen A)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-559s21c1
Sequence:CCGGACCTGGCTCCTTCCTGTATTACTCGAGTAATACAGGAAGGAGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-272s21c1
Sequence:CCGGATGGAGTACTTCGGCACTATCCTCGAGGATAGTGCCGAAGTACTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-1008s21c1
Sequence:CCGGACATCGTCTTCACCATCAATGCTCGAGCATTGATGGTGAAGACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-1149s21c1
Sequence:CCGGTCTTCATCCGCCAGTACTTTACTCGAGTAAAGTACTGGCGGATGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-312s21c1
Sequence:CCGGAGGATTTCACCGTCGTCTTTGCTCGAGCAAAGACGACGGTGAAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079808
PGA4 MISSION shRNA Lentiviral Transduction Particles
pepsinogen 4, group I (pepsinogen A)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-559s21c1
Sequence:CCGGACCTGGCTCCTTCCTGTATTACTCGAGTAATACAGGAAGGAGCCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-272s21c1
Sequence:CCGGATGGAGTACTTCGGCACTATCCTCGAGGATAGTGCCGAAGTACTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-1008s21c1
Sequence:CCGGACATCGTCTTCACCATCAATGCTCGAGCATTGATGGTGAAGACGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-1149s21c1
Sequence:CCGGTCTTCATCCGCCAGTACTTTACTCGAGTAAAGTACTGGCGGATGAAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079808.1-312s21c1
Sequence:CCGGAGGATTTCACCGTCGTCTTTGCTCGAGCAAAGACGACGGTGAAATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)