EMAIL THIS PAGE TO A FRIEND

PGAM1

phosphoglycerate mutase 1 (brain)

28 Gene Product Result for
Synonyms: PGAM-B PGAMA
UniProtKB ID: P18669, Q9BWC0
Gene ID:
Human(5223) Summary: Phosphoglyceric acid mutase (EC 2.7.5.3) is widely distributed in mammalian tissues where it catalyzes the reversible reaction of 3-phosphoglycerate (3-PGA) to 2-phosphoglycerate (2-PGA) in the glycolytic pathway (summary by Chen et al., 1974 [PubMed 4811757]
Mouse(18648) phosphoglycerate mutase 1
Rat(24642) phosphoglycerate mutase 1 (brain)
chicken(428969) phosphoglycerate mutase 1 (brain)
domestic cat(101099081) phosphoglycerate mutase 1 (brain)
dog(477786) phosphoglycerate mutase 1 (brain)
naked mole-rat(101725467) phosphoglycerate mutase 1 (brain)
domestic guinea pig(100718830) phosphoglycerate mutase 1 (brain)
cow(404148) phosphoglycerate mutase 1 (brain)
sheep(101108532) phosphoglycerate mutase 1 (brain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002629 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053290 Rosetta Predictions rat pricing
NM_023418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082210 predicted 1114
2 SASI_Rn01_00082211 predicted 728
3 SASI_Rn01_00082212 predicted 1123
4 SASI_Rn01_00082213 predicted 1101
5 SASI_Rn01_00082214 predicted 1311
6 SASI_Rn01_00082215 predicted 1124
7 SASI_Rn01_00082216 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050821 predicted 1010
2 SASI_Mm02_00327109 predicted 754
3 SASI_Mm01_00050827 predicted 312
4 SASI_Mm01_00050828 predicted 846
5 SASI_Mm01_00050823 predicted 1274
6 SASI_Mm01_00050824 predicted 1193
7 SASI_Mm01_00050825 predicted 1273
8 SASI_Mm01_00050826 predicted 849
9 SASI_Mm01_00050830 predicted 1193
10 SASI_Mm02_00327110 predicted 1280
11 SASI_Mm01_00050822 predicted 776
12 SASI_Mm01_00050829 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002629
VALIDATED
PGAM1 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate mutase 1 (brain)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-325s1c1
Sequence:CCGGCCGGTCTCAATAAAGCAGAAACTCGAGTTTCTGCTTTATTGAGACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-531s1c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATACTCGAGTATTTCTTCATTCCAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-493s1c1
Sequence:CCGGCCTGTGAGAGTCTGAAGGATACTCGAGTATCCTTCAGACTCTCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002629.2-294s1c1
Sequence:CCGGCGCCTCAATGAGCGGCACTATCTCGAGATAGTGCCGCTCATTGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-425s1c1
Sequence:CCGGCCATCCTTTCTACAGCAACATCTCGAGATGTTGCTGTAGAAAGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-498s21c1
Sequence:CCGGGAGAGTCTGAAGGATACTATTCTCGAGAATAGTATCCTTCAGACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-531s21c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATACTCGAGTATTTCTTCATTCCAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-318s21c1
Sequence:CCGGGGTCTAACCGGTCTCAATAAACTCGAGTTTATTGAGACCGGTTAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-1051s21c1
Sequence:CCGGCCTTATCCAACAGAGTTTAAACTCGAGTTTAAACTCTGTTGGATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-425s21c1
Sequence:CCGGCCATCCTTTCTACAGCAACATCTCGAGATGTTGCTGTAGAAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002629
VALIDATED
PGAM1 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate mutase 1 (brain)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-325s1c1
Sequence:CCGGCCGGTCTCAATAAAGCAGAAACTCGAGTTTCTGCTTTATTGAGACCGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-531s1c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATACTCGAGTATTTCTTCATTCCAGAAGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-493s1c1
Sequence:CCGGCCTGTGAGAGTCTGAAGGATACTCGAGTATCCTTCAGACTCTCACAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002629.2-294s1c1
Sequence:CCGGCGCCTCAATGAGCGGCACTATCTCGAGATAGTGCCGCTCATTGAGGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-425s1c1
Sequence:CCGGCCATCCTTTCTACAGCAACATCTCGAGATGTTGCTGTAGAAAGGATGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000330628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-498s21c1
Sequence:CCGGGAGAGTCTGAAGGATACTATTCTCGAGAATAGTATCCTTCAGACTCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000330571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-531s21c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATACTCGAGTATTTCTTCATTCCAGAAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000353685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-318s21c1
Sequence:CCGGGGTCTAACCGGTCTCAATAAACTCGAGTTTATTGAGACCGGTTAGACCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000330627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-1051s21c1
Sequence:CCGGCCTTATCCAACAGAGTTTAAACTCGAGTTTAAACTCTGTTGGATAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000330570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-425s21c1
Sequence:CCGGCCATCCTTTCTACAGCAACATCTCGAGATGTTGCTGTAGAAAGGATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002629
VALIDATED
PGAM1 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate mutase 1 (brain)
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000029469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-325s1c1
Sequence:CCGGCCGGTCTCAATAAAGCAGAAACTCGAGTTTCTGCTTTATTGAGACCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-531s1c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATACTCGAGTATTTCTTCATTCCAGAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-493s1c1
Sequence:CCGGCCTGTGAGAGTCTGAAGGATACTCGAGTATCCTTCAGACTCTCACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002629.2-294s1c1
Sequence:CCGGCGCCTCAATGAGCGGCACTATCTCGAGATAGTGCCGCTCATTGAGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002629.2-425s1c1
Sequence:CCGGCCATCCTTTCTACAGCAACATCTCGAGATGTTGCTGTAGAAAGGATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-498s21c1
Sequence:CCGGGAGAGTCTGAAGGATACTATTCTCGAGAATAGTATCCTTCAGACTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-531s21c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATACTCGAGTATTTCTTCATTCCAGAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-318s21c1
Sequence:CCGGGGTCTAACCGGTCTCAATAAACTCGAGTTTATTGAGACCGGTTAGACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-1051s21c1
Sequence:CCGGCCTTATCCAACAGAGTTTAAACTCGAGTTTAAACTCTGTTGGATAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002629.2-425s21c1
Sequence:CCGGCCATCCTTTCTACAGCAACATCTCGAGATGTTGCTGTAGAAAGGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023418
VALIDATED
PGAM1 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate mutase 1 (brain)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-1359s1c1
Sequence:CCGGCCCTAGAAGGTTGGGATCAATCTCGAGATTGATCCCAACCTTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-345s1c1
Sequence:CCGGCGCCTCAATGAGCGACACTATCTCGAGATAGTGTCGCTCATTGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-737s1c1
Sequence:CCGGCGTCTATGAACTGGACAAGAACTCGAGTTCTTGTCCAGTTCATAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-582s1c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATTCTCGAGAATTTCTTCATTCCAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023418.2-1452s21c1
Sequence:CCGGCCCTAGAAGGTTGGGATCAATCTCGAGATTGATCCCAACCTTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023418.2-825s21c1
Sequence:CCGGCGTCTATGAACTGGACAAGAACTCGAGTTCTTGTCCAGTTCATAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023418.1-386s1c1
Sequence:CCGGCAAAGCAGAAACTGCTGCTAACTCGAGTTAGCAGCAGTTTCTGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023418.2-670s21c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATTCTCGAGAATTTCTTCATTCCAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023418.2-433s21c1
Sequence:CCGGCGCCTCAATGAGCGACACTATCTCGAGATAGTGTCGCTCATTGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023418
VALIDATED
PGAM1 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate mutase 1 (brain)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-1359s1c1
Sequence:CCGGCCCTAGAAGGTTGGGATCAATCTCGAGATTGATCCCAACCTTCTAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000115265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-345s1c1
Sequence:CCGGCGCCTCAATGAGCGACACTATCTCGAGATAGTGTCGCTCATTGAGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000115264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-737s1c1
Sequence:CCGGCGTCTATGAACTGGACAAGAACTCGAGTTCTTGTCCAGTTCATAGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000115262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-582s1c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATTCTCGAGAATTTCTTCATTCCAGAAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000319914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023418.2-1452s21c1
Sequence:CCGGCCCTAGAAGGTTGGGATCAATCTCGAGATTGATCCCAACCTTCTAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000319843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023418.2-825s21c1
Sequence:CCGGCGTCTATGAACTGGACAAGAACTCGAGTTCTTGTCCAGTTCATAGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000115263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023418.1-386s1c1
Sequence:CCGGCAAAGCAGAAACTGCTGCTAACTCGAGTTAGCAGCAGTTTCTGCTTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000319842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023418.2-670s21c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATTCTCGAGAATTTCTTCATTCCAGAAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000319911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023418.2-433s21c1
Sequence:CCGGCGCCTCAATGAGCGACACTATCTCGAGATAGTGTCGCTCATTGAGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023418
VALIDATED
PGAM1 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate mutase 1 (brain)
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000115261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-1359s1c1
Sequence:CCGGCCCTAGAAGGTTGGGATCAATCTCGAGATTGATCCCAACCTTCTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-345s1c1
Sequence:CCGGCGCCTCAATGAGCGACACTATCTCGAGATAGTGTCGCTCATTGAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-737s1c1
Sequence:CCGGCGTCTATGAACTGGACAAGAACTCGAGTTCTTGTCCAGTTCATAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023418.1-582s1c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATTCTCGAGAATTTCTTCATTCCAGAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023418.2-1452s21c1
Sequence:CCGGCCCTAGAAGGTTGGGATCAATCTCGAGATTGATCCCAACCTTCTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023418.2-825s21c1
Sequence:CCGGCGTCTATGAACTGGACAAGAACTCGAGTTCTTGTCCAGTTCATAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023418.1-386s1c1
Sequence:CCGGCAAAGCAGAAACTGCTGCTAACTCGAGTTAGCAGCAGTTTCTGCTTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023418.2-670s21c1
Sequence:CCGGCCCTTCTGGAATGAAGAAATTCTCGAGAATTTCTTCATTCCAGAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023418.2-433s21c1
Sequence:CCGGCGCCTCAATGAGCGACACTATCTCGAGATAGTGTCGCTCATTGAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)