EMAIL THIS PAGE TO A FRIEND

PGAM1P8

phosphoglycerate mutase 1 pseudogene 8

23 Gene Product Result for
Species: Human PGAM1P8(440043)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_495879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_495879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_495879 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_495879 Rosetta Predictions human pricing
XR_015812 Rosetta Predictions human pricing
XR_015843 Rosetta Predictions human pricing
XR_040617 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs01_00278734 predicted 1917
2 SASI_Hs01_00278735 predicted 1714
3 SASI_Hs01_00278736 predicted 1721
4 SASI_Hs01_00278737 predicted 1933
5 SASI_Hs01_00278738 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs02_00489246 predicted 1975
2 SASI_Hs02_00489247 predicted 1963
3 SASI_Hs02_00489248 predicted 1936
4 SASI_Hs02_00489249 predicted 2169
5 SASI_Hs02_00489250 predicted 2170
6 SASI_Hs02_00489251 predicted 2246
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs02_00489308 predicted 1969
2 SASI_Hs02_00489309 predicted 1968
3 SASI_Hs02_00489310 predicted 1936
4 SASI_Hs02_00489311 predicted 2174
5 SASI_Hs02_00489312 predicted 2165
6 SASI_Hs02_00489313 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs02_00520438 predicted 1972
2 SASI_Hs02_00520439 predicted 1962
3 SASI_Hs02_00520440 predicted 1934
4 SASI_Hs02_00520441 predicted 2167
5 SASI_Hs02_00520442 predicted 2168
6 SASI_Hs02_00520443 predicted 2241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_495879
PGAM1P8 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate mutase 1 pseudogene 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-334s1c1
Sequence:CCGGGCTCTGACCTTCTGGAATGAACTCGAGTTCATTCCAGAAGGTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_495879.1-859s1c1
Sequence:CCGGCCCTTATCCAACAGAGTTTAACTCGAGTTAAACTCTGTTGGATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-485s1c1
Sequence:CCGGGTATTCCCATTGTCTATGAATCTCGAGATTCATAGACAATGGGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-550s1c1
Sequence:CCGGGATGAAGAGATGGTACGCAAACTCGAGTTTGCGTACCATCTCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-234s1c1
Sequence:CCGGCCATCCTTTCTATAGCAACATCTCGAGATGTTGCTATAGAAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_495879
PGAM1P8 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate mutase 1 pseudogene 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-334s1c1
Sequence:CCGGGCTCTGACCTTCTGGAATGAACTCGAGTTCATTCCAGAAGGTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_495879.1-859s1c1
Sequence:CCGGCCCTTATCCAACAGAGTTTAACTCGAGTTAAACTCTGTTGGATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-485s1c1
Sequence:CCGGGTATTCCCATTGTCTATGAATCTCGAGATTCATAGACAATGGGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-550s1c1
Sequence:CCGGGATGAAGAGATGGTACGCAAACTCGAGTTTGCGTACCATCTCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-234s1c1
Sequence:CCGGCCATCCTTTCTATAGCAACATCTCGAGATGTTGCTATAGAAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_495879
PGAM1P8 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate mutase 1 pseudogene 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-334s1c1
Sequence:CCGGGCTCTGACCTTCTGGAATGAACTCGAGTTCATTCCAGAAGGTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_495879.1-859s1c1
Sequence:CCGGCCCTTATCCAACAGAGTTTAACTCGAGTTAAACTCTGTTGGATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-485s1c1
Sequence:CCGGGTATTCCCATTGTCTATGAATCTCGAGATTCATAGACAATGGGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-550s1c1
Sequence:CCGGGATGAAGAGATGGTACGCAAACTCGAGTTTGCGTACCATCTCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495879.1-234s1c1
Sequence:CCGGCCATCCTTTCTATAGCAACATCTCGAGATGTTGCTATAGAAAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)