EMAIL THIS PAGE TO A FRIEND

PGAM2

phosphoglycerate mutase 2 (muscle)

58 Gene Product Result for
Synonyms: GSD10 PGAM-M PGAMM
UniProtKB ID: P15259
Gene ID:
Human(5224) Summary: Phosphoglycerate mutase (PGAM) catalyzes the reversible reaction of 3-phosphoglycerate (3-PGA) to 2-phosphoglycerate (2-PGA) in the glycolytic pathway. The PGAM is a dimeric enzyme containing, in different tissues, different proportions of a slow-migrating muscle (MM) isozyme, a fast-migrating brain (BB) isozyme, and a hybrid form (MB). This gene encodes muscle-specific PGAM subunit. Mutations in this gene cause muscle phosphoglycerate mutase eficiency, also known as glycogen storage disease X. [provided by RefSeq, Sep 2009]
Mouse(56012) phosphoglycerate mutase 2
Rat(24959) phosphoglycerate mutase 2 (muscle)
Zebrafish(572733) phosphoglycerate mutase 2 (muscle)
domestic cat(101094834) phosphoglycerate mutase 2 (muscle)
dog(475495) phosphoglycerate mutase 2 (muscle)
cow(515067) phosphoglycerate mutase 2 (muscle)
sheep(101123502) phosphoglycerate mutase 2 (muscle)
domestic guinea pig(100728679) phosphoglycerate mutase 2 (muscle)
naked mole-rat(101723534) phosphoglycerate mutase 2 (muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000290 Rosetta Predictions human pricing
NM_017328 Rosetta Predictions rat pricing
NM_018870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037889 predicted 555
2 SASI_Hs02_00302252 predicted 443
3 SASI_Hs01_00037890 predicted 488
4 SASI_Hs01_00037891 predicted 487
5 SASI_Hs01_00037892 predicted 488
6 SASI_Hs01_00037893 predicted 577
7 SASI_Hs01_00037894 predicted 560
8 SASI_Hs01_00037895 predicted 265
9 SASI_Hs01_00037896 predicted 562
10 SASI_Hs01_00037897 predicted 520
11 SASI_Hs01_00037898 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059196 predicted 516
2 SASI_Rn01_00059197 predicted 296
3 SASI_Rn01_00059198 predicted 344
4 SASI_Rn02_00261784 predicted 352
5 SASI_Rn01_00059199 predicted 567
6 SASI_Rn01_00059200 predicted 529
7 SASI_Rn01_00059202 predicted 222
8 SASI_Rn01_00059203 predicted 515
9 SASI_Rn01_00059204 predicted 195
10 SASI_Rn01_00059205 predicted 552
11 SASI_Rn01_00059201 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173875 predicted 240
2 SASI_Mm01_00173876 predicted 545
3 SASI_Mm01_00173877 predicted 552
4 SASI_Mm01_00173878 predicted 371
5 SASI_Mm02_00324250 predicted 523
6 SASI_Mm01_00173881 predicted 374
7 SASI_Mm01_00173882 predicted 288
8 SASI_Mm02_00324251 predicted 544
9 SASI_Mm02_00324252 predicted 242
10 SASI_Mm02_00324253 predicted 413
11 SASI_Mm01_00173879 predicted 489
12 SASI_Mm01_00173880 predicted 581
13 SASI_Mm01_00173883 predicted 253
14 SASI_Mm01_00173884 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000290
PGAM2 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate mutase 2 (muscle)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-428s1c1
Sequence:CCGGCTACTACAACTCCATTAGCAACTCGAGTTGCTAATGGAGTTGTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-679s1c1
Sequence:CCGGCCATTGTGTATGAGCTGAACACTCGAGTGTTCAGCTCATACACAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-176s1c1
Sequence:CCGGTGCCAAGATGGAGTTTGACATCTCGAGATGTCAAACTCCATCTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-527s1c1
Sequence:CCGGGCCCTTCTGGAACGAGGAGATCTCGAGATCTCCTCGTTCCAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-322s1c2
Sequence:CCGGCAGGCTTCAACAAGGCAGAAACTCGAGTTTCTGCCTTGTTGAAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000290.3-655s21c1
Sequence:CCGGGATGTCAGACCAGGCGATCATCTCGAGATGATCGCCTGGTCTGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000290.3-603s21c1
Sequence:CCGGTCATTGCAGCCCACGGGAACACTCGAGTGTTCCCGTGGGCTGCAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000290
PGAM2 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate mutase 2 (muscle)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-428s1c1
Sequence:CCGGCTACTACAACTCCATTAGCAACTCGAGTTGCTAATGGAGTTGTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-679s1c1
Sequence:CCGGCCATTGTGTATGAGCTGAACACTCGAGTGTTCAGCTCATACACAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-176s1c1
Sequence:CCGGTGCCAAGATGGAGTTTGACATCTCGAGATGTCAAACTCCATCTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-527s1c1
Sequence:CCGGGCCCTTCTGGAACGAGGAGATCTCGAGATCTCCTCGTTCCAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-322s1c2
Sequence:CCGGCAGGCTTCAACAAGGCAGAAACTCGAGTTTCTGCCTTGTTGAAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000290.3-655s21c1
Sequence:CCGGGATGTCAGACCAGGCGATCATCTCGAGATGATCGCCTGGTCTGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000290.3-603s21c1
Sequence:CCGGTCATTGCAGCCCACGGGAACACTCGAGTGTTCCCGTGGGCTGCAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000290
PGAM2 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate mutase 2 (muscle)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-428s1c1
Sequence:CCGGCTACTACAACTCCATTAGCAACTCGAGTTGCTAATGGAGTTGTAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-679s1c1
Sequence:CCGGCCATTGTGTATGAGCTGAACACTCGAGTGTTCAGCTCATACACAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-176s1c1
Sequence:CCGGTGCCAAGATGGAGTTTGACATCTCGAGATGTCAAACTCCATCTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-527s1c1
Sequence:CCGGGCCCTTCTGGAACGAGGAGATCTCGAGATCTCCTCGTTCCAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000290.1-322s1c2
Sequence:CCGGCAGGCTTCAACAAGGCAGAAACTCGAGTTTCTGCCTTGTTGAAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000290.3-655s21c1
Sequence:CCGGGATGTCAGACCAGGCGATCATCTCGAGATGATCGCCTGGTCTGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000290.3-603s21c1
Sequence:CCGGTCATTGCAGCCCACGGGAACACTCGAGTGTTCCCGTGGGCTGCAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018870
VALIDATED
PGAM2 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate mutase 2 (muscle)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-171s1c1
Sequence:CCGGCACCGCTATCAAAGATGCCAACTCGAGTTGGCATCTTTGATAGCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-583s1c1
Sequence:CCGGAGAGTGCTTATTGCAGCCCATCTCGAGATGGGCTGCAATAAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-174s1c1
Sequence:CCGGCGCTATCAAAGATGCCAAGATCTCGAGATCTTGGCATCTTTGATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-192s1c1
Sequence:CCGGGATAGAGTTTGACATCTGCTACTCGAGTAGCAGATGTCAAACTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-84s1c1
Sequence:CCGGGAGCTTATGGAACCAAGAGAACTCGAGTTCTCTTGGTTCCATAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018870.3-558s21c1
Sequence:CCGGGCCTACCTGTGAAAGTCTCAACTCGAGTTGAGACTTTCACAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-134s21c1
Sequence:CCGGTTCGCCACGGTGAGAGCTTATCTCGAGATAAGCTCTCACCGTGGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-637s21c1
Sequence:CCGGGCTGGCCAGAGAGTGCTTATTCTCGAGAATAAGCACTCTCTGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018870.3-309s21c1
Sequence:CCGGTTGGACCATCCTGGATGTTACCTCGAGGTAACATCCAGGATGGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-387s21c1
Sequence:CCGGTGGCCTCACAGGCCTCAATAACTCGAGTTATTGAGGCCTGTGAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-446s21c1
Sequence:CCGGAGATCTGGAGGCGTTCCTTTGCTCGAGCAAAGGAACGCCTCCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-476s21c1
Sequence:CCGGCACCACCCATGGATGAGAAACCTCGAGGTTTCTCATCCATGGGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018870
VALIDATED
PGAM2 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate mutase 2 (muscle)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-171s1c1
Sequence:CCGGCACCGCTATCAAAGATGCCAACTCGAGTTGGCATCTTTGATAGCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-583s1c1
Sequence:CCGGAGAGTGCTTATTGCAGCCCATCTCGAGATGGGCTGCAATAAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-174s1c1
Sequence:CCGGCGCTATCAAAGATGCCAAGATCTCGAGATCTTGGCATCTTTGATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-192s1c1
Sequence:CCGGGATAGAGTTTGACATCTGCTACTCGAGTAGCAGATGTCAAACTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-84s1c1
Sequence:CCGGGAGCTTATGGAACCAAGAGAACTCGAGTTCTCTTGGTTCCATAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018870.3-558s21c1
Sequence:CCGGGCCTACCTGTGAAAGTCTCAACTCGAGTTGAGACTTTCACAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-134s21c1
Sequence:CCGGTTCGCCACGGTGAGAGCTTATCTCGAGATAAGCTCTCACCGTGGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-637s21c1
Sequence:CCGGGCTGGCCAGAGAGTGCTTATTCTCGAGAATAAGCACTCTCTGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018870.3-309s21c1
Sequence:CCGGTTGGACCATCCTGGATGTTACCTCGAGGTAACATCCAGGATGGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-387s21c1
Sequence:CCGGTGGCCTCACAGGCCTCAATAACTCGAGTTATTGAGGCCTGTGAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-446s21c1
Sequence:CCGGAGATCTGGAGGCGTTCCTTTGCTCGAGCAAAGGAACGCCTCCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-476s21c1
Sequence:CCGGCACCACCCATGGATGAGAAACCTCGAGGTTTCTCATCCATGGGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018870
VALIDATED
PGAM2 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate mutase 2 (muscle)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-171s1c1
Sequence:CCGGCACCGCTATCAAAGATGCCAACTCGAGTTGGCATCTTTGATAGCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-583s1c1
Sequence:CCGGAGAGTGCTTATTGCAGCCCATCTCGAGATGGGCTGCAATAAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-174s1c1
Sequence:CCGGCGCTATCAAAGATGCCAAGATCTCGAGATCTTGGCATCTTTGATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-192s1c1
Sequence:CCGGGATAGAGTTTGACATCTGCTACTCGAGTAGCAGATGTCAAACTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018870.1-84s1c1
Sequence:CCGGGAGCTTATGGAACCAAGAGAACTCGAGTTCTCTTGGTTCCATAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018870.3-558s21c1
Sequence:CCGGGCCTACCTGTGAAAGTCTCAACTCGAGTTGAGACTTTCACAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-134s21c1
Sequence:CCGGTTCGCCACGGTGAGAGCTTATCTCGAGATAAGCTCTCACCGTGGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-637s21c1
Sequence:CCGGGCTGGCCAGAGAGTGCTTATTCTCGAGAATAAGCACTCTCTGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018870.3-309s21c1
Sequence:CCGGTTGGACCATCCTGGATGTTACCTCGAGGTAACATCCAGGATGGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-387s21c1
Sequence:CCGGTGGCCTCACAGGCCTCAATAACTCGAGTTATTGAGGCCTGTGAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-446s21c1
Sequence:CCGGAGATCTGGAGGCGTTCCTTTGCTCGAGCAAAGGAACGCCTCCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018870.3-476s21c1
Sequence:CCGGCACCACCCATGGATGAGAAACCTCGAGGTTTCTCATCCATGGGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)