EMAIL THIS PAGE TO A FRIEND

PGAM4

phosphoglycerate mutase family member 4

54 Gene Product Result for
Synonyms: PGAM-B PGAM1 PGAM3 dJ1000K24.1
Species: Human PGAM4(441531)
UniProtKB ID: Q8N0Y7, Q5JPN2, Q8NI24, Q8NI25, Q8NI26
Gene ID:
Human(441531) Summary: This intronless gene appears to have arisen from a retrotransposition event, yet it is thought to be an expressed, protein-coding gene. The encoded protein is a member of the phosphoglycerate mutase family, a set of enzymes that catalyze the transfer of a phosphate group from 3-phosphoglycerate to 2-phosphoglycerate. [provided by RefSeq, May 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301286 ANTI-PGAM4 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029891 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029891 Rosetta Predictions human pricing
XM_925963 Rosetta Predictions human pricing
XM_930828 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092837 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298850 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278948 predicted 633
2 SASI_Hs01_00278949 predicted 635
3 SASI_Hs01_00278950 predicted 881
4 SASI_Hs01_00278951 predicted 141
5 SASI_Hs01_00278952 predicted 19
6 SASI_Hs01_00278953 predicted 146
7 SASI_Hs01_00278954 predicted 177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029891
PGAM4 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate mutase family member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000148872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029891.1-1526s1c1
Sequence:CCGGCCTTGTTTCATGGCAGTGAAACTCGAGTTTCACTGCCATGAAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029891.1-1219s1c1
Sequence:CCGGCCAGTGGAAGATGAATGTAATCTCGAGATTACATTCATCTTCCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029891.1-510s1c1
Sequence:CCGGGCCCTTCTGGAATGAAGAAATCTCGAGATTTCTTCATTCCAGAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029891.1-681s1c1
Sequence:CCGGCAAGAACTTGAAGCCTATCAACTCGAGTTGATAGGCTTCAAGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029891
PGAM4 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate mutase family member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000148872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029891.1-1526s1c1
Sequence:CCGGCCTTGTTTCATGGCAGTGAAACTCGAGTTTCACTGCCATGAAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029891.1-1219s1c1
Sequence:CCGGCCAGTGGAAGATGAATGTAATCTCGAGATTACATTCATCTTCCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029891.1-510s1c1
Sequence:CCGGGCCCTTCTGGAATGAAGAAATCTCGAGATTTCTTCATTCCAGAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029891.1-681s1c1
Sequence:CCGGCAAGAACTTGAAGCCTATCAACTCGAGTTGATAGGCTTCAAGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029891
PGAM4 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate mutase family member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000148872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029891.1-1526s1c1
Sequence:CCGGCCTTGTTTCATGGCAGTGAAACTCGAGTTTCACTGCCATGAAACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029891.1-1219s1c1
Sequence:CCGGCCAGTGGAAGATGAATGTAATCTCGAGATTACATTCATCTTCCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029891.1-510s1c1
Sequence:CCGGGCCCTTCTGGAATGAAGAAATCTCGAGATTTCTTCATTCCAGAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029891.1-681s1c1
Sequence:CCGGCAAGAACTTGAAGCCTATCAACTCGAGTTGATAGGCTTCAAGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)