EMAIL THIS PAGE TO A FRIEND

PGAM5

phosphoglycerate mutase family member 5

56 Gene Product Result for
Synonyms: BXLBV68
UniProtKB ID: Q96HS1, A9LN06, C9IZY7, Q96JB0
Gene ID:
Mouse(72542) phosphoglycerate mutase family member 5
Rat(288731) phosphoglycerate mutase family member 5
fruit fly(31143) Phosphoglycerate mutase 5
domestic cat(101096675) phosphoglycerate mutase family member 5
dog(486221) phosphoglycerate mutase family member 5
chicken(416789) phosphoglycerate mutase family member 5
Zebrafish(492357) phosphoglycerate mutase family member 5
naked mole-rat(101721089) phosphoglycerate mutase family member 5
domestic guinea pig(100726231) phosphoglycerate mutase family member 5
cow(508608) phosphoglycerate mutase family member 5
sheep(101115655) phosphoglycerate mutase family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138575 Rosetta Predictions human pricing
XM_001713960 Rosetta Predictions human pricing
NM_001025272 Rosetta Predictions rat pricing
NM_028273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199604 predicted 487
2 SASI_Hs01_00199605 predicted 519
3 SASI_Hs01_00199606 predicted 571
4 SASI_Hs01_00199607 predicted 571
5 SASI_Hs01_00199608 predicted 480
6 SASI_Hs01_00199609 predicted 640
7 SASI_Hs01_00199611 predicted 592
8 SASI_Hs01_00199612 predicted 600
9 SASI_Hs01_00199613 predicted 580
10 SASI_Hs02_00363730 predicted 722
11 SASI_Hs01_00199610 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00394084 predicted 812
2 SASI_Hs02_00394085 predicted 1010
3 SASI_Hs02_00394086 predicted 800
4 SASI_Hs02_00394087 predicted 795
5 SASI_Hs02_00394088 predicted 1035
6 SASI_Hs02_00394089 predicted 1436
7 SASI_Hs02_00394090 predicted 1361
8 SASI_Hs02_00394091 predicted 803
9 SASI_Hs02_00394092 predicted 782
10 SASI_Hs02_00394093 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203086 predicted 232
2 SASI_Rn01_00085388 predicted 719
3 SASI_Rn01_00085389 predicted 717
4 SASI_Rn01_00085390 predicted 1051
5 SASI_Rn02_00203087 predicted 1014
6 SASI_Rn01_00085393 predicted 1013
7 SASI_Rn01_00085394 predicted 707
8 SASI_Rn02_00203088 predicted 1168
9 SASI_Rn01_00085387 predicted 998
10 SASI_Rn02_00203089 predicted 564
11 SASI_Rn01_00085391 predicted 1002
12 SASI_Rn01_00085392 predicted 302
13 SASI_Rn01_00085395 predicted 303
14 SASI_Rn01_00085396 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049194 predicted 1010
2 SASI_Mm01_00049195 predicted 1003
3 SASI_Mm01_00049196 predicted 989
4 SASI_Mm01_00049197 predicted 570
5 SASI_Mm02_00333634 predicted 721
6 SASI_Mm02_00333635 predicted 713
7 SASI_Mm01_00049198 predicted 308
8 SASI_Mm01_00049199 predicted 482
9 SASI_Mm01_00049200 predicted 438
10 SASI_Mm01_00049201 predicted 1045
11 SASI_Mm01_00049192 predicted 947
12 SASI_Mm01_00049193 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028273
VALIDATED
PGAM5 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate mutase family member 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028273.2-630s21c1
Sequence:CCGGATGAAGATGGAGCCCGGATTGCTCGAGCAATCCGGGCTCCATCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028273.1-1846s1c1
Sequence:CCGGCCATCTTGTAAATGTTGGGATCTCGAGATCCCAACATTTACAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028273.1-451s1c1
Sequence:CCGGGCCTGGGATTAAAGTTTAATACTCGAGTATTAAACTTTAATCCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028273.2-279s21c1
Sequence:CCGGCTGGAGAAGACGAGTTGACATCTCGAGATGTCAACTCGTCTTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028273.1-1346s1c1
Sequence:CCGGCCAACTTCTCAGCTCAATTAACTCGAGTTAATTGAGCTGAGAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028273.1-713s1c1
Sequence:CCGGGATCTTCATATGCCATGCCAACTCGAGTTGGCATGGCATATGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028273.1-280s1c1
Sequence:CCGGCTGGAGAAGACGAGTTGACATCTCGAGATGTCAACTCGTCTTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028273.2-1345s21c1
Sequence:CCGGCCAACTTCTCAGCTCAATTAACTCGAGTTAATTGAGCTGAGAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028273.2-450s21c1
Sequence:CCGGGCCTGGGATTAAAGTTTAATACTCGAGTATTAAACTTTAATCCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028273.2-794s21c1
Sequence:CCGGTCCCTCAACAACGGCAGTATCCTCGAGGATACTGCCGTTGTTGAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028273
VALIDATED
PGAM5 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate mutase family member 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028273.2-630s21c1
Sequence:CCGGATGAAGATGGAGCCCGGATTGCTCGAGCAATCCGGGCTCCATCTTCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000197660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028273.1-1846s1c1
Sequence:CCGGCCATCTTGTAAATGTTGGGATCTCGAGATCCCAACATTTACAAGATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000177473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028273.1-451s1c1
Sequence:CCGGGCCTGGGATTAAAGTTTAATACTCGAGTATTAAACTTTAATCCCAGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000297693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028273.2-279s21c1
Sequence:CCGGCTGGAGAAGACGAGTTGACATCTCGAGATGTCAACTCGTCTTCTCCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000176629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028273.1-1346s1c1
Sequence:CCGGCCAACTTCTCAGCTCAATTAACTCGAGTTAATTGAGCTGAGAAGTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000178389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028273.1-713s1c1
Sequence:CCGGGATCTTCATATGCCATGCCAACTCGAGTTGGCATGGCATATGAAGATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000198997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028273.1-280s1c1
Sequence:CCGGCTGGAGAAGACGAGTTGACATCTCGAGATGTCAACTCGTCTTCTCCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000279543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028273.2-1345s21c1
Sequence:CCGGCCAACTTCTCAGCTCAATTAACTCGAGTTAATTGAGCTGAGAAGTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000279544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028273.2-450s21c1
Sequence:CCGGGCCTGGGATTAAAGTTTAATACTCGAGTATTAAACTTTAATCCCAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000279545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028273.2-794s21c1
Sequence:CCGGTCCCTCAACAACGGCAGTATCCTCGAGGATACTGCCGTTGTTGAGGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028273
VALIDATED
PGAM5 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate mutase family member 5
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000297694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028273.2-630s21c1
Sequence:CCGGATGAAGATGGAGCCCGGATTGCTCGAGCAATCCGGGCTCCATCTTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028273.1-1846s1c1
Sequence:CCGGCCATCTTGTAAATGTTGGGATCTCGAGATCCCAACATTTACAAGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028273.1-451s1c1
Sequence:CCGGGCCTGGGATTAAAGTTTAATACTCGAGTATTAAACTTTAATCCCAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028273.2-279s21c1
Sequence:CCGGCTGGAGAAGACGAGTTGACATCTCGAGATGTCAACTCGTCTTCTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028273.1-1346s1c1
Sequence:CCGGCCAACTTCTCAGCTCAATTAACTCGAGTTAATTGAGCTGAGAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028273.1-713s1c1
Sequence:CCGGGATCTTCATATGCCATGCCAACTCGAGTTGGCATGGCATATGAAGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028273.1-280s1c1
Sequence:CCGGCTGGAGAAGACGAGTTGACATCTCGAGATGTCAACTCGTCTTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028273.2-1345s21c1
Sequence:CCGGCCAACTTCTCAGCTCAATTAACTCGAGTTAATTGAGCTGAGAAGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028273.2-450s21c1
Sequence:CCGGGCCTGGGATTAAAGTTTAATACTCGAGTATTAAACTTTAATCCCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028273.2-794s21c1
Sequence:CCGGTCCCTCAACAACGGCAGTATCCTCGAGGATACTGCCGTTGTTGAGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138575
VALIDATED
PGAM5 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate mutase family member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_138575.2-600s21c1
Sequence:CCGGGCCGGAAGCTGTGCAGTATTACTCGAGTAATACTGCACAGCTTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_138575.2-684s21c1
Sequence:CCGGGGAGGAGGACAGTTACGAAATCTCGAGATTTCGTAACTGTCCTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138575.2-1009s21c1
Sequence:CCGGCTGCAATCAGCCACTTCTTTACTCGAGTAAAGAAGTGGCTGATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_138575.2-287s21c1
Sequence:CCGGCCAAGCTGGACCACTACAAAGCTCGAGCTTTGTAGTGGTCCAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138575.2-483s21c1
Sequence:CCGGCGCCATAGAGACCACCGATATCTCGAGATATCGGTGGTCTCTATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138575
VALIDATED
PGAM5 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate mutase family member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_138575.2-600s21c1
Sequence:CCGGGCCGGAAGCTGTGCAGTATTACTCGAGTAATACTGCACAGCTTCCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000245654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_138575.2-684s21c1
Sequence:CCGGGGAGGAGGACAGTTACGAAATCTCGAGATTTCGTAACTGTCCTCCTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000245655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138575.2-1009s21c1
Sequence:CCGGCTGCAATCAGCCACTTCTTTACTCGAGTAAAGAAGTGGCTGATTGCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000245653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_138575.2-287s21c1
Sequence:CCGGCCAAGCTGGACCACTACAAAGCTCGAGCTTTGTAGTGGTCCAGCTTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000245651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138575.2-483s21c1
Sequence:CCGGCGCCATAGAGACCACCGATATCTCGAGATATCGGTGGTCTCTATGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138575
VALIDATED
PGAM5 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate mutase family member 5
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000245652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_138575.2-600s21c1
Sequence:CCGGGCCGGAAGCTGTGCAGTATTACTCGAGTAATACTGCACAGCTTCCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_138575.2-684s21c1
Sequence:CCGGGGAGGAGGACAGTTACGAAATCTCGAGATTTCGTAACTGTCCTCCTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138575.2-1009s21c1
Sequence:CCGGCTGCAATCAGCCACTTCTTTACTCGAGTAAAGAAGTGGCTGATTGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_138575.2-287s21c1
Sequence:CCGGCCAAGCTGGACCACTACAAAGCTCGAGCTTTGTAGTGGTCCAGCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138575.2-483s21c1
Sequence:CCGGCGCCATAGAGACCACCGATATCTCGAGATATCGGTGGTCTCTATGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)