EMAIL THIS PAGE TO A FRIEND

PGAP1

post-GPI attachment to proteins 1

361 Gene Product Result for
Synonyms: Bst1 ISPD3024
Gene ID:
Human(80055) Summary: PGAP1 catalyzes the inositol deacylation of glycosylphosphatidylinositol (GPI) at an early step in GPI biosynthesis. Inositol deacylation is essential for the generation of mature GPI capable of attachment to proteins (Tanaka et al., 2004 [PubMed 14734546]
Mouse(241062) post-GPI attachment to proteins 1
Rat(316400) post-GPI attachment to proteins 1
Zebrafish(100147850) post-GPI attachment to proteins 1
chicken(424054) post-GPI attachment to proteins 1
dog(612828) post-GPI attachment to proteins 1
domestic cat(101083194) post-GPI attachment to proteins 1
Horse(100070459) post-GPI attachment to proteins 1
cow(504677) post-GPI attachment to proteins 1
sheep(101120808) post-GPI attachment to proteins 1
domestic guinea pig(100724070) post-GPI attachment to proteins 1
naked mole-rat(101709275) post-GPI attachment to proteins 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024989 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024989 Rosetta Predictions human pricing
NM_201990 Rosetta Predictions rat pricing
XM_892623 Rosetta Predictions mouse pricing
XM_907025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017464 predicted 2617
2 SASI_Hs02_00357641 predicted 1503
3 SASI_Hs01_00017465 predicted 1786
4 SASI_Hs02_00357642 predicted 569
5 SASI_Hs01_00017467 predicted 842
6 SASI_Hs01_00017470 predicted 2554
7 SASI_Hs02_00357643 predicted 1177
8 SASI_Hs01_00017471 predicted 852
9 SASI_Hs01_00017472 predicted 2501
10 SASI_Hs02_00357644 predicted 1147
11 SASI_Hs01_00017466 predicted 1706
12 SASI_Hs01_00017468 predicted 937
13 SASI_Hs01_00017469 predicted 1273
14 SASI_Hs01_00017473 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076106 predicted 1328
2 SASI_Rn01_00076107 predicted 316
3 SASI_Rn02_00270345 predicted 2474
4 SASI_Rn01_00076108 predicted 1090
5 SASI_Rn01_00076109 predicted 532
6 SASI_Rn01_00076112 predicted 1361
7 SASI_Rn02_00270346 predicted 2516
8 SASI_Rn02_00270347 predicted 831
9 SASI_Rn01_00076113 predicted 589
10 SASI_Rn01_00076114 predicted 1310
11 SASI_Rn01_00076105 predicted 1608
12 SASI_Rn01_00076110 predicted 340
13 SASI_Rn01_00076111 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251502 predicted 395
2 SASI_Mm01_00251503 predicted 962
3 SASI_Mm02_00429190 predicted 874
4 SASI_Mm02_00429191 predicted 790
5 SASI_Mm01_00251504 predicted 406
6 SASI_Mm01_00251506 predicted 1135
7 SASI_Mm01_00251507 predicted 913
8 SASI_Mm01_00251509 predicted 281
9 SASI_Mm01_00251510 predicted 662
10 SASI_Mm02_00429192 predicted 1123
11 SASI_Mm01_00251501 predicted 1393
12 SASI_Mm01_00251505 predicted 1383
13 SASI_Mm01_00251508 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432969 predicted 2487
2 SASI_Mm02_00432970 predicted 2608
3 SASI_Mm02_00432971 predicted 392
4 SASI_Mm02_00432972 predicted 2550
5 SASI_Mm02_00432973 predicted 409
6 SASI_Mm02_00432974 predicted 1174
7 SASI_Mm02_00432975 predicted 1408
8 SASI_Mm02_00432976 predicted 1691
9 SASI_Mm02_00432977 predicted 1813
10 SASI_Mm02_00432978 predicted 2346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024989
VALIDATED
PGAP1 MISSION shRNA Bacterial Glycerol Stock
post-GPI attachment to proteins 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024989.3-571s21c1
Sequence:CCGGACAATTCTCAAACTCTATAAGCTCGAGCTTATAGAGTTTGAGAATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024989.3-3294s21c1
Sequence:CCGGTGCTATAGTTTACCTATTAAGCTCGAGCTTAATAGGTAAACTATAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-184s1c1
Sequence:CCGGCCCGCATATGAGTTGTATCTTCTCGAGAAGATACAACTCATATGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-1009s1c1
Sequence:CCGGCCAGCTATAATTTCTGACTTACTCGAGTAAGTCAGAAATTATAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-1879s1c1
Sequence:CCGGGCTACCATGTTGGATAAAGAACTCGAGTTCTTTATCCAACATGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024989.2-2153s1c1
Sequence:CCGGCCTCTGAACTTCCTAAAGATACTCGAGTATCTTTAGGAAGTTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-941s1c1
Sequence:CCGGCCAAGAAGAAACTGTCAGTTTCTCGAGAAACTGACAGTTTCTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024989
VALIDATED
PGAP1 MISSION shRNA shRNA Plasmid DNA
post-GPI attachment to proteins 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024989.3-571s21c1
Sequence:CCGGACAATTCTCAAACTCTATAAGCTCGAGCTTATAGAGTTTGAGAATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024989.3-3294s21c1
Sequence:CCGGTGCTATAGTTTACCTATTAAGCTCGAGCTTAATAGGTAAACTATAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-184s1c1
Sequence:CCGGCCCGCATATGAGTTGTATCTTCTCGAGAAGATACAACTCATATGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-1009s1c1
Sequence:CCGGCCAGCTATAATTTCTGACTTACTCGAGTAAGTCAGAAATTATAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-1879s1c1
Sequence:CCGGGCTACCATGTTGGATAAAGAACTCGAGTTCTTTATCCAACATGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024989.2-2153s1c1
Sequence:CCGGCCTCTGAACTTCCTAAAGATACTCGAGTATCTTTAGGAAGTTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-941s1c1
Sequence:CCGGCCAAGAAGAAACTGTCAGTTTCTCGAGAAACTGACAGTTTCTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024989
VALIDATED
PGAP1 MISSION shRNA Lentiviral Transduction Particles
post-GPI attachment to proteins 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024989.3-571s21c1
Sequence:CCGGACAATTCTCAAACTCTATAAGCTCGAGCTTATAGAGTTTGAGAATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024989.3-3294s21c1
Sequence:CCGGTGCTATAGTTTACCTATTAAGCTCGAGCTTAATAGGTAAACTATAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-184s1c1
Sequence:CCGGCCCGCATATGAGTTGTATCTTCTCGAGAAGATACAACTCATATGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-1009s1c1
Sequence:CCGGCCAGCTATAATTTCTGACTTACTCGAGTAAGTCAGAAATTATAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-1879s1c1
Sequence:CCGGGCTACCATGTTGGATAAAGAACTCGAGTTCTTTATCCAACATGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024989.2-2153s1c1
Sequence:CCGGCCTCTGAACTTCCTAAAGATACTCGAGTATCTTTAGGAAGTTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024989.2-941s1c1
Sequence:CCGGCCAAGAAGAAACTGTCAGTTTCTCGAGAAACTGACAGTTTCTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)