EMAIL THIS PAGE TO A FRIEND

PGAP2

post-GPI attachment to proteins 2

42 Gene Product Result for
Synonyms: CWH43-N FRAG1 HPMRS3 MRT17 MRT21
UniProtKB ID: Q9UHJ9, E9PJG5, Q6UC77, Q96G66, Q9UF01, Q9Y4N1
Gene ID:
Mouse(233575) post-GPI attachment to proteins 2
Rat(116675) post-GPI attachment to proteins 2
naked mole-rat(101705489) post-GPI attachment to proteins 2
domestic guinea pig(100727636) post-GPI attachment to proteins 2
cow(540520) post-GPI attachment to proteins 2
sheep(101117104) post-GPI attachment to proteins 2
Zebrafish(541417) post-GPI attachment to proteins 2
domestic cat(101087265) post-GPI attachment to proteins 2
dog(485216) post-GPI attachment to proteins 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014489 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014489 Rosetta Predictions human pricing
NM_053895 Rosetta Predictions rat pricing
NM_145583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196891 predicted 263
2 SASI_Hs01_00196892 predicted 1117
3 SASI_Hs01_00196893 predicted 915
4 SASI_Hs01_00196895 predicted 473
5 SASI_Hs01_00196898 predicted 916
6 SASI_Hs01_00196899 predicted 781
7 SASI_Hs01_00196900 predicted 671
8 SASI_Hs02_00345738 predicted 836
9 SASI_Hs02_00345739 predicted 538
10 SASI_Hs02_00345740 predicted 209
11 SASI_Hs01_00196894 predicted 398
12 SASI_Hs01_00196896 predicted 352
13 SASI_Hs01_00196897 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111847 predicted 882
2 SASI_Rn01_00111848 predicted 1317
3 SASI_Rn01_00111849 predicted 1358
4 SASI_Rn01_00111851 predicted 860
5 SASI_Rn02_00266815 predicted 1302
6 SASI_Rn01_00111852 predicted 802
7 SASI_Rn01_00111853 predicted 1316
8 SASI_Rn01_00111854 predicted 759
9 SASI_Rn02_00266816 predicted 1419
10 SASI_Rn02_00266817 predicted 1382
11 SASI_Rn01_00111846 predicted 1235
12 SASI_Rn01_00111850 predicted 1431
13 SASI_Rn01_00111855 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073326 predicted 365
2 SASI_Mm01_00073327 predicted 787
3 SASI_Mm01_00073328 predicted 539
4 SASI_Mm01_00073329 predicted 605
5 SASI_Mm01_00073330 predicted 840
6 SASI_Mm02_00341119 predicted 792
7 SASI_Mm01_00073331 predicted 279
8 SASI_Mm01_00073333 predicted 231
9 SASI_Mm01_00073334 predicted 473
10 SASI_Mm01_00073335 predicted 862
11 SASI_Mm01_00073332 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014489
VALIDATED
PGAP2 MISSION shRNA Bacterial Glycerol Stock
post-GPI attachment to proteins 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014489.2-1268s21c1
Sequence:CCGGGTCCTCAAACATCACCTTTACCTCGAGGTAAAGGTGATGTTTGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014489.1-1373s1c1
Sequence:CCGGCCATCCAGTTTCTGGCCTTTACTCGAGTAAAGGCCAGAAACTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014489.1-974s1c1
Sequence:CCGGCACTGTTGTCTTAACCAACATCTCGAGATGTTGGTTAAGACAACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014489.1-687s1c1
Sequence:CCGGGCGTTGCTAGTGCTCACTTATCTCGAGATAAGTGAGCACTAGCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014489.1-434s1c1
Sequence:CCGGCCTGGTGTTCCACTTTGAGTACTCGAGTACTCAAAGTGGAACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014489.1-407s1c1
Sequence:CCGGCGGCTTCTTCTTCTGCATCATCTCGAGATGATGCAGAAGAAGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014489.2-1476s21c1
Sequence:CCGGTTCATAGGACTAATGTATTTCCTCGAGGAAATACATTAGTCCTATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014489.2-911s21c1
Sequence:CCGGACTTTCGGCACAACATGTATTCTCGAGAATACATGTTGTGCCGAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014489.2-1026s21c1
Sequence:CCGGGAACAAGGAGCTGCTCATAACCTCGAGGTTATGAGCAGCTCCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014489
VALIDATED
PGAP2 MISSION shRNA shRNA Plasmid DNA
post-GPI attachment to proteins 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014489.2-1268s21c1
Sequence:CCGGGTCCTCAAACATCACCTTTACCTCGAGGTAAAGGTGATGTTTGAGGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014489.1-1373s1c1
Sequence:CCGGCCATCCAGTTTCTGGCCTTTACTCGAGTAAAGGCCAGAAACTGGATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014489.1-974s1c1
Sequence:CCGGCACTGTTGTCTTAACCAACATCTCGAGATGTTGGTTAAGACAACAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014489.1-687s1c1
Sequence:CCGGGCGTTGCTAGTGCTCACTTATCTCGAGATAAGTGAGCACTAGCAACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014489.1-434s1c1
Sequence:CCGGCCTGGTGTTCCACTTTGAGTACTCGAGTACTCAAAGTGGAACACCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000061455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014489.1-407s1c1
Sequence:CCGGCGGCTTCTTCTTCTGCATCATCTCGAGATGATGCAGAAGAAGAAGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000435086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014489.2-1476s21c1
Sequence:CCGGTTCATAGGACTAATGTATTTCCTCGAGGAAATACATTAGTCCTATGAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000425524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014489.2-911s21c1
Sequence:CCGGACTTTCGGCACAACATGTATTCTCGAGAATACATGTTGTGCCGAAAGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000412622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014489.2-1026s21c1
Sequence:CCGGGAACAAGGAGCTGCTCATAACCTCGAGGTTATGAGCAGCTCCTTGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014489
VALIDATED
PGAP2 MISSION shRNA Lentiviral Transduction Particles
post-GPI attachment to proteins 2
Human
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000426168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014489.2-1268s21c1
Sequence:CCGGGTCCTCAAACATCACCTTTACCTCGAGGTAAAGGTGATGTTTGAGGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014489.1-1373s1c1
Sequence:CCGGCCATCCAGTTTCTGGCCTTTACTCGAGTAAAGGCCAGAAACTGGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014489.1-974s1c1
Sequence:CCGGCACTGTTGTCTTAACCAACATCTCGAGATGTTGGTTAAGACAACAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014489.1-687s1c1
Sequence:CCGGGCGTTGCTAGTGCTCACTTATCTCGAGATAAGTGAGCACTAGCAACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014489.1-434s1c1
Sequence:CCGGCCTGGTGTTCCACTTTGAGTACTCGAGTACTCAAAGTGGAACACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014489.1-407s1c1
Sequence:CCGGCGGCTTCTTCTTCTGCATCATCTCGAGATGATGCAGAAGAAGAAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014489.2-1476s21c1
Sequence:CCGGTTCATAGGACTAATGTATTTCCTCGAGGAAATACATTAGTCCTATGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014489.2-911s21c1
Sequence:CCGGACTTTCGGCACAACATGTATTCTCGAGAATACATGTTGTGCCGAAAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014489.2-1026s21c1
Sequence:CCGGGAACAAGGAGCTGCTCATAACCTCGAGGTTATGAGCAGCTCCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145583
VALIDATED
PGAP2 MISSION shRNA Bacterial Glycerol Stock
post-GPI attachment to proteins 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145583.2-789s21c1
Sequence:CCGGACTTCCGGCACAACATGTATTCTCGAGAATACATGTTGTGCCGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145583.2-465s21c1
Sequence:CCGGTCTTGACAGCCTTCGCCTATTCTCGAGAATAGGCGAAGGCTGTCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.1-742s1c1
Sequence:CCGGGCTCTTCGTCATCAACTTCATCTCGAGATGAAGTTGATGACGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.1-748s1c1
Sequence:CCGGCGTCATCAACTTCATCTCCTTCTCGAGAAGGAGATGAAGTTGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.1-901s1c1
Sequence:CCGGCGGGAACAAAGAGCTGCTAATCTCGAGATTAGCAGCTCTTTGTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.2-540s1c1
Sequence:CCGGGCATTAACTTCAGTCTCAATGCTCGAGCATTGAGACTGAAGTTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145583.2-903s21c1
Sequence:CCGGGGAACAAAGAGCTGCTAATAACTCGAGTTATTAGCAGCTCTTTGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145583.2-994s21c1
Sequence:CCGGTCCCTATCTCCACGTTCTCTCCTCGAGGAGAGAACGTGGAGATAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145583.2-540s21c1
Sequence:CCGGGCATTAACTTCAGTCTCAATGCTCGAGCATTGAGACTGAAGTTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145583
VALIDATED
PGAP2 MISSION shRNA shRNA Plasmid DNA
post-GPI attachment to proteins 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145583.2-789s21c1
Sequence:CCGGACTTCCGGCACAACATGTATTCTCGAGAATACATGTTGTGCCGGAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000262950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145583.2-465s21c1
Sequence:CCGGTCTTGACAGCCTTCGCCTATTCTCGAGAATAGGCGAAGGCTGTCAAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.1-742s1c1
Sequence:CCGGGCTCTTCGTCATCAACTTCATCTCGAGATGAAGTTGATGACGAAGAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000173445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.1-748s1c1
Sequence:CCGGCGTCATCAACTTCATCTCCTTCTCGAGAAGGAGATGAAGTTGATGACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000173815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.1-901s1c1
Sequence:CCGGCGGGAACAAAGAGCTGCTAATCTCGAGATTAGCAGCTCTTTGTTCCCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000215409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.2-540s1c1
Sequence:CCGGGCATTAACTTCAGTCTCAATGCTCGAGCATTGAGACTGAAGTTAATGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000262952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145583.2-903s21c1
Sequence:CCGGGGAACAAAGAGCTGCTAATAACTCGAGTTATTAGCAGCTCTTTGTTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000262949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145583.2-994s21c1
Sequence:CCGGTCCCTATCTCCACGTTCTCTCCTCGAGGAGAGAACGTGGAGATAGGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000281571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145583.2-540s21c1
Sequence:CCGGGCATTAACTTCAGTCTCAATGCTCGAGCATTGAGACTGAAGTTAATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145583
VALIDATED
PGAP2 MISSION shRNA Lentiviral Transduction Particles
post-GPI attachment to proteins 2
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000262951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145583.2-789s21c1
Sequence:CCGGACTTCCGGCACAACATGTATTCTCGAGAATACATGTTGTGCCGGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145583.2-465s21c1
Sequence:CCGGTCTTGACAGCCTTCGCCTATTCTCGAGAATAGGCGAAGGCTGTCAAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.1-742s1c1
Sequence:CCGGGCTCTTCGTCATCAACTTCATCTCGAGATGAAGTTGATGACGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.1-748s1c1
Sequence:CCGGCGTCATCAACTTCATCTCCTTCTCGAGAAGGAGATGAAGTTGATGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.1-901s1c1
Sequence:CCGGCGGGAACAAAGAGCTGCTAATCTCGAGATTAGCAGCTCTTTGTTCCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145583.2-540s1c1
Sequence:CCGGGCATTAACTTCAGTCTCAATGCTCGAGCATTGAGACTGAAGTTAATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145583.2-903s21c1
Sequence:CCGGGGAACAAAGAGCTGCTAATAACTCGAGTTATTAGCAGCTCTTTGTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145583.2-994s21c1
Sequence:CCGGTCCCTATCTCCACGTTCTCTCCTCGAGGAGAGAACGTGGAGATAGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145583.2-540s21c1
Sequence:CCGGGCATTAACTTCAGTCTCAATGCTCGAGCATTGAGACTGAAGTTAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)