EMAIL THIS PAGE TO A FRIEND

PGAP3

post-GPI attachment to proteins 3

95 Gene Product Result for
Synonyms: AGLA546 CAB2 PER1 PERLD1 PP1498
UniProtKB ID: Q96FM1, Q86Z03, Q8NBJ8
Gene ID:
Mouse(320655) post-GPI attachment to proteins 3
chicken(431201) post-GPI attachment to proteins 3
domestic cat(101091739) post-GPI attachment to proteins 3
dog(491022) post-GPI attachment to proteins 3
cow(513258) post-GPI attachment to proteins 3
sheep(101104078) post-GPI attachment to proteins 3
domestic guinea pig(100724461) post-GPI attachment to proteins 3
naked mole-rat(101705836) post-GPI attachment to proteins 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063041 MISSION® esiRNA esiRNA human PERLD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033419 Rosetta Predictions human pricing
NM_001033537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202027 predicted 287
2 SASI_Hs01_00202028 predicted 543
3 SASI_Hs01_00202029 predicted 682
4 SASI_Hs01_00202030 predicted 886
5 SASI_Hs01_00202031 predicted 556
6 SASI_Hs01_00202032 predicted 540
7 SASI_Hs01_00202033 predicted 1484
8 SASI_Hs01_00202034 predicted 233
9 SASI_Hs01_00202036 predicted 1066
10 SASI_Hs02_00361315 predicted 552
11 SASI_Hs01_00202035 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096186 predicted 597
2 SASI_Mm01_00096187 predicted 655
3 SASI_Mm01_00096188 predicted 572
4 SASI_Mm01_00096189 predicted 288
5 SASI_Mm01_00096190 predicted 806
6 SASI_Mm01_00096191 predicted 775
7 SASI_Mm01_00096192 predicted 347
8 SASI_Mm01_00096193 predicted 445
9 SASI_Mm01_00096194 predicted 847
10 SASI_Mm02_00288904 predicted 382
11 SASI_Mm01_00096195 predicted 255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033419
PGAP3 MISSION shRNA Bacterial Glycerol Stock
post-GPI attachment to proteins 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033419.3-1261s21c1
Sequence:CCGGTGGAACTGAGTGTGCTCTTAGCTCGAGCTAAGAGCACACTCAGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033419.3-1099s1c1
Sequence:CCGGCAACTTCTTGAACTTGGACATCTCGAGATGTCCAAGTTCAAGAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-241s1c1
Sequence:CCGGCGACTGTAAGTATGAGTGTATCTCGAGATACACTCATACTTACAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-973s1c1
Sequence:CCGGGAAGGAATCAGAGGACAAGTTCTCGAGAACTTGTCCTCTGATTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-561s1c1
Sequence:CCGGCCACTGTCATCCTACACTCAACTCGAGTTGAGTGTAGGATGACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033419.3-858s21c1
Sequence:CCGGTTGACTTCCCACCGCTCTTCTCTCGAGAGAAGAGCGGTGGGAAGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033419.3-686s21c1
Sequence:CCGGAGCCTCATCCGCTTCGACTATCTCGAGATAGTCGAAGCGGATGAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033419.3-478s21c1
Sequence:CCGGGTCCCTCAATGCATGGTTCTGCTCGAGCAGAACCATGCATTGAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-199s1c1
Sequence:CCGGCCAGCCAATCTACATGAGTCTCTCGAGAGACTCATGTAGATTGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033419
PGAP3 MISSION shRNA shRNA Plasmid DNA
post-GPI attachment to proteins 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033419.3-1261s21c1
Sequence:CCGGTGGAACTGAGTGTGCTCTTAGCTCGAGCTAAGAGCACACTCAGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033419.3-1099s1c1
Sequence:CCGGCAACTTCTTGAACTTGGACATCTCGAGATGTCCAAGTTCAAGAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-241s1c1
Sequence:CCGGCGACTGTAAGTATGAGTGTATCTCGAGATACACTCATACTTACAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-973s1c1
Sequence:CCGGGAAGGAATCAGAGGACAAGTTCTCGAGAACTTGTCCTCTGATTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-561s1c1
Sequence:CCGGCCACTGTCATCCTACACTCAACTCGAGTTGAGTGTAGGATGACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033419.3-858s21c1
Sequence:CCGGTTGACTTCCCACCGCTCTTCTCTCGAGAGAAGAGCGGTGGGAAGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033419.3-686s21c1
Sequence:CCGGAGCCTCATCCGCTTCGACTATCTCGAGATAGTCGAAGCGGATGAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033419.3-478s21c1
Sequence:CCGGGTCCCTCAATGCATGGTTCTGCTCGAGCAGAACCATGCATTGAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-199s1c1
Sequence:CCGGCCAGCCAATCTACATGAGTCTCTCGAGAGACTCATGTAGATTGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033419
PGAP3 MISSION shRNA Lentiviral Transduction Particles
post-GPI attachment to proteins 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033419.3-1261s21c1
Sequence:CCGGTGGAACTGAGTGTGCTCTTAGCTCGAGCTAAGAGCACACTCAGTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033419.3-1099s1c1
Sequence:CCGGCAACTTCTTGAACTTGGACATCTCGAGATGTCCAAGTTCAAGAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-241s1c1
Sequence:CCGGCGACTGTAAGTATGAGTGTATCTCGAGATACACTCATACTTACAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-973s1c1
Sequence:CCGGGAAGGAATCAGAGGACAAGTTCTCGAGAACTTGTCCTCTGATTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-561s1c1
Sequence:CCGGCCACTGTCATCCTACACTCAACTCGAGTTGAGTGTAGGATGACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033419.3-858s21c1
Sequence:CCGGTTGACTTCCCACCGCTCTTCTCTCGAGAGAAGAGCGGTGGGAAGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033419.3-686s21c1
Sequence:CCGGAGCCTCATCCGCTTCGACTATCTCGAGATAGTCGAAGCGGATGAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033419.3-478s21c1
Sequence:CCGGGTCCCTCAATGCATGGTTCTGCTCGAGCAGAACCATGCATTGAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033419.3-199s1c1
Sequence:CCGGCCAGCCAATCTACATGAGTCTCTCGAGAGACTCATGTAGATTGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033537
PGAP3 MISSION shRNA Bacterial Glycerol Stock
post-GPI attachment to proteins 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.1-638s1c1
Sequence:CCGGCACATATCCTACCTGAGCCTTCTCGAGAAGGCTCAGGTAGGATATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033537.1-1891s1c1
Sequence:CCGGCCCTTTGCACTCCACTCAAATCTCGAGATTTGAGTGGAGTGCAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.2-294s1c1
Sequence:CCGGGACTGCAAGTATGAGTGTATGCTCGAGCATACACTCATACTTGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033537.1-1709s1c2
Sequence:CCGGGAGATGAACATGCACCGGATACTCGAGTATCCGGTGCATGTTCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.2-618s1c1
Sequence:CCGGGTCATCCTGCATTCTGTTTACCTCGAGGTAAACAGAATGCAGGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.2-1039s1c1
Sequence:CCGGCCATGTTCAAGCTGGACTAAACTCGAGTTTAGTCCAGCTTGAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.1-167s1c1
Sequence:CCGGCAGCCAATCTACATGAGCCTACTCGAGTAGGCTCATGTAGATTGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033537.1-2007s1c1
Sequence:CCGGCCTGGTTCTTTATCTTGGGATCTCGAGATCCCAAGATAAAGAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.1-661s1c1
Sequence:CCGGCCATTTCGACTACGGCTACAACTCGAGTTGTAGCCGTAGTCGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033537
PGAP3 MISSION shRNA shRNA Plasmid DNA
post-GPI attachment to proteins 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.1-638s1c1
Sequence:CCGGCACATATCCTACCTGAGCCTTCTCGAGAAGGCTCAGGTAGGATATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033537.1-1891s1c1
Sequence:CCGGCCCTTTGCACTCCACTCAAATCTCGAGATTTGAGTGGAGTGCAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.2-294s1c1
Sequence:CCGGGACTGCAAGTATGAGTGTATGCTCGAGCATACACTCATACTTGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033537.1-1709s1c2
Sequence:CCGGGAGATGAACATGCACCGGATACTCGAGTATCCGGTGCATGTTCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.2-618s1c1
Sequence:CCGGGTCATCCTGCATTCTGTTTACCTCGAGGTAAACAGAATGCAGGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.2-1039s1c1
Sequence:CCGGCCATGTTCAAGCTGGACTAAACTCGAGTTTAGTCCAGCTTGAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.1-167s1c1
Sequence:CCGGCAGCCAATCTACATGAGCCTACTCGAGTAGGCTCATGTAGATTGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033537.1-2007s1c1
Sequence:CCGGCCTGGTTCTTTATCTTGGGATCTCGAGATCCCAAGATAAAGAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.1-661s1c1
Sequence:CCGGCCATTTCGACTACGGCTACAACTCGAGTTGTAGCCGTAGTCGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033537
PGAP3 MISSION shRNA Lentiviral Transduction Particles
post-GPI attachment to proteins 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.1-638s1c1
Sequence:CCGGCACATATCCTACCTGAGCCTTCTCGAGAAGGCTCAGGTAGGATATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033537.1-1891s1c1
Sequence:CCGGCCCTTTGCACTCCACTCAAATCTCGAGATTTGAGTGGAGTGCAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.2-294s1c1
Sequence:CCGGGACTGCAAGTATGAGTGTATGCTCGAGCATACACTCATACTTGCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033537.1-1709s1c2
Sequence:CCGGGAGATGAACATGCACCGGATACTCGAGTATCCGGTGCATGTTCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.2-618s1c1
Sequence:CCGGGTCATCCTGCATTCTGTTTACCTCGAGGTAAACAGAATGCAGGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.2-1039s1c1
Sequence:CCGGCCATGTTCAAGCTGGACTAAACTCGAGTTTAGTCCAGCTTGAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.1-167s1c1
Sequence:CCGGCAGCCAATCTACATGAGCCTACTCGAGTAGGCTCATGTAGATTGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033537.1-2007s1c1
Sequence:CCGGCCTGGTTCTTTATCTTGGGATCTCGAGATCCCAAGATAAAGAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033537.1-661s1c1
Sequence:CCGGCCATTTCGACTACGGCTACAACTCGAGTTGTAGCCGTAGTCGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)