EMAIL THIS PAGE TO A FRIEND

PGBD2

piggyBac transposable element derived 2

71 Gene Product Result for
UniProtKB ID: Q6P3X8, B3KVR8, Q6MZF8
Gene ID:
Human(267002) Summary: The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. The exact function of this gene is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(287304) piggyBac transposable element derived 2
cow(101907155) piggyBac transposable element derived 2
cow(540000) piggyBac transposable element derived 2
naked mole-rat(101725223) piggyBac transposable element derived 2
domestic guinea pig(100735520) piggyBac transposable element derived 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170725 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010711 MISSION® esiRNA esiRNA targeting human PGBD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017434 Rosetta Predictions human pricing
NM_170725 Rosetta Predictions human pricing
XR_005466 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097468 predicted 886
2 SASI_Hs01_00097469 predicted 1089
3 SASI_Hs01_00097471 predicted 1093
4 SASI_Hs01_00097472 predicted 1039
5 SASI_Hs01_00097473 predicted 1178
6 SASI_Hs01_00097474 predicted 901
7 SASI_Hs01_00097475 predicted 438
8 SASI_Hs01_00097476 predicted 1016
9 SASI_Hs02_00306756 predicted 815
10 SASI_Hs01_00097477 predicted 471
11 SASI_Hs01_00097470 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072965 predicted 1564
2 SASI_Hs01_00072966 predicted 1768
3 SASI_Hs01_00072968 predicted 1767
4 SASI_Hs01_00072969 predicted 1713
5 SASI_Hs01_00072970 predicted 1849
6 SASI_Hs01_00072971 predicted 1584
7 SASI_Hs01_00072972 predicted 1113
8 SASI_Hs01_00072973 predicted 1695
9 SASI_Hs02_00367686 predicted 1486
10 SASI_Hs01_00072974 predicted 1155
11 SASI_Hs01_00072967 predicted 1884
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409410 predicted 617
2 SASI_Rn02_00409411 predicted 622
3 SASI_Rn02_00409412 predicted 663
4 SASI_Rn02_00409413 predicted 667
5 SASI_Rn02_00409414 predicted 269
6 SASI_Rn02_00409415 predicted 260
7 SASI_Rn02_00409416 predicted 607
8 SASI_Rn02_00409417 predicted 331
9 SASI_Rn02_00409418 predicted 338
10 SASI_Rn02_00409419 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170725
PGBD2 MISSION shRNA Bacterial Glycerol Stock
piggyBac transposable element derived 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170725.2-895s21c1
Sequence:CCGGATCCGGATGAACTGCAATTTCCTCGAGGAAATTGCAGTTCATCCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170725.2-2295s21c1
Sequence:CCGGTAAGATAGGCAATAGTGTATACTCGAGTATACACTATTGCCTATCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170725.2-943s21c1
Sequence:CCGGTACAGCTTTGGCGAGTCTATGCTCGAGCATAGACTCGCCAAAGCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-246s1c1
Sequence:CCGGGAGTCCAACAACAACAGGGAACTCGAGTTCCCTGTTGTTGTTGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1397s1c1
Sequence:CCGGCGTGGTCAACATTTGCTCCAACTCGAGTTGGAGCAAATGTTGACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-459s1c1
Sequence:CCGGGTTGTGAAACCTCAGCGCATTCTCGAGAATGCGCTGAGGTTTCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170725.2-2093s21c1
Sequence:CCGGTTATGCCTACATGTGATATAACTCGAGTTATATCACATGTAGGCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1586s1c1
Sequence:CCGGGAAGTGGTACTCAAGCTTTATCTCGAGATAAAGCTTGAGTACCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1799s1c1
Sequence:CCGGGCACTGGATTATCCATCAGGACTCGAGTCCTGATGGATAATCCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1776s1c1
Sequence:CCGGGAGAGCCGCTTCGATATGATTCTCGAGAATCATATCGAAGCGGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170725
PGBD2 MISSION shRNA shRNA Plasmid DNA
piggyBac transposable element derived 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170725.2-895s21c1
Sequence:CCGGATCCGGATGAACTGCAATTTCCTCGAGGAAATTGCAGTTCATCCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170725.2-2295s21c1
Sequence:CCGGTAAGATAGGCAATAGTGTATACTCGAGTATACACTATTGCCTATCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170725.2-943s21c1
Sequence:CCGGTACAGCTTTGGCGAGTCTATGCTCGAGCATAGACTCGCCAAAGCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-246s1c1
Sequence:CCGGGAGTCCAACAACAACAGGGAACTCGAGTTCCCTGTTGTTGTTGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1397s1c1
Sequence:CCGGCGTGGTCAACATTTGCTCCAACTCGAGTTGGAGCAAATGTTGACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-459s1c1
Sequence:CCGGGTTGTGAAACCTCAGCGCATTCTCGAGAATGCGCTGAGGTTTCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170725.2-2093s21c1
Sequence:CCGGTTATGCCTACATGTGATATAACTCGAGTTATATCACATGTAGGCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1586s1c1
Sequence:CCGGGAAGTGGTACTCAAGCTTTATCTCGAGATAAAGCTTGAGTACCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1799s1c1
Sequence:CCGGGCACTGGATTATCCATCAGGACTCGAGTCCTGATGGATAATCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1776s1c1
Sequence:CCGGGAGAGCCGCTTCGATATGATTCTCGAGAATCATATCGAAGCGGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170725
PGBD2 MISSION shRNA Lentiviral Transduction Particles
piggyBac transposable element derived 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170725.2-895s21c1
Sequence:CCGGATCCGGATGAACTGCAATTTCCTCGAGGAAATTGCAGTTCATCCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170725.2-2295s21c1
Sequence:CCGGTAAGATAGGCAATAGTGTATACTCGAGTATACACTATTGCCTATCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170725.2-943s21c1
Sequence:CCGGTACAGCTTTGGCGAGTCTATGCTCGAGCATAGACTCGCCAAAGCTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-246s1c1
Sequence:CCGGGAGTCCAACAACAACAGGGAACTCGAGTTCCCTGTTGTTGTTGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1397s1c1
Sequence:CCGGCGTGGTCAACATTTGCTCCAACTCGAGTTGGAGCAAATGTTGACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-459s1c1
Sequence:CCGGGTTGTGAAACCTCAGCGCATTCTCGAGAATGCGCTGAGGTTTCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170725.2-2093s21c1
Sequence:CCGGTTATGCCTACATGTGATATAACTCGAGTTATATCACATGTAGGCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1586s1c1
Sequence:CCGGGAAGTGGTACTCAAGCTTTATCTCGAGATAAAGCTTGAGTACCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1799s1c1
Sequence:CCGGGCACTGGATTATCCATCAGGACTCGAGTCCTGATGGATAATCCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170725.1-1776s1c1
Sequence:CCGGGAGAGCCGCTTCGATATGATTCTCGAGAATCATATCGAAGCGGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)