EMAIL THIS PAGE TO A FRIEND

PGBD3

piggyBac transposable element derived 3

27 Gene Product Result for
Species: Human PGBD3(267004)
UniProtKB ID: Q8N328, B3KQC4, Q5W0M0, Q6PIH0
Gene ID:
Human(267004) Summary: This gene is a member of a small family of genes derived from piggyBac transposable elements. The encoded protein contains a zinc-ribbon domain characteristic of transposon-derived proteins and may function as a regulator of transcription. Naturally-occurring readthrough transcription occurs between this gene and the adjacent ERCC6 gene (GeneID 2074), and results in a fusion protein that shares sequence with the product of each individual gene. The readthrough locus is represented by GeneID:101243544. There are several pseudogenes for this gene on chromosomes 4, 5 and 12. [provided by RefSeq, Mar 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170753 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221461 MISSION® esiRNA esiRNA targeting human PGBD3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170753 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367721 predicted 1021
2 SASI_Hs01_00192046 predicted 893
3 SASI_Hs01_00192047 predicted 306
4 SASI_Hs02_00367722 predicted 863
5 SASI_Hs02_00367723 predicted 1876
6 SASI_Hs02_00367724 predicted 932
7 SASI_Hs01_00192049 predicted 1006
8 SASI_Hs02_00367725 predicted 1596
9 SASI_Hs01_00192052 predicted 745
10 SASI_Hs01_00192053 predicted 708
11 SASI_Hs01_00192044 predicted 871
12 SASI_Hs01_00192045 predicted 1378
13 SASI_Hs01_00192048 predicted 488
14 SASI_Hs01_00192050 predicted 1401
15 SASI_Hs01_00192051 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170753
VALIDATED
PGBD3 MISSION shRNA Bacterial Glycerol Stock
piggyBac transposable element derived 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170753.1-2015s1c1
Sequence:CCGGCCGTTGAATATCACACTGAATCTCGAGATTCAGTGTGATATTCAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170753.1-436s1c1
Sequence:CCGGGCTGCGTATCTTATTCAAGATCTCGAGATCTTGAATAAGATACGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170753.1-997s1c1
Sequence:CCGGCCTCTCATAAGCAAACTTAATCTCGAGATTAAGTTTGCTTATGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170753.1-1879s1c1
Sequence:CCGGCGTAACATTGACTCACGTTATCTCGAGATAACGTGAGTCAATGTTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170753.1-680s1c1
Sequence:CCGGCCACAGAAATTCTTGAACTTTCTCGAGAAAGTTCAAGAATTTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170753.2-946s21c1
Sequence:CCGGGACCGGTTTGAAACTATATTTCTCGAGAAATATAGTTTCAAACCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170753.2-1699s21c1
Sequence:CCGGGATAAGTATCGGGCATCAATCCTCGAGGATTGATGCCCGATACTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170753.2-1156s21c1
Sequence:CCGGCCCATTCGGTTTGGCTATAAGCTCGAGCTTATAGCCAAACCGAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170753
VALIDATED
PGBD3 MISSION shRNA shRNA Plasmid DNA
piggyBac transposable element derived 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170753.1-2015s1c1
Sequence:CCGGCCGTTGAATATCACACTGAATCTCGAGATTCAGTGTGATATTCAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170753.1-436s1c1
Sequence:CCGGGCTGCGTATCTTATTCAAGATCTCGAGATCTTGAATAAGATACGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170753.1-997s1c1
Sequence:CCGGCCTCTCATAAGCAAACTTAATCTCGAGATTAAGTTTGCTTATGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170753.1-1879s1c1
Sequence:CCGGCGTAACATTGACTCACGTTATCTCGAGATAACGTGAGTCAATGTTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170753.1-680s1c1
Sequence:CCGGCCACAGAAATTCTTGAACTTTCTCGAGAAAGTTCAAGAATTTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170753.2-946s21c1
Sequence:CCGGGACCGGTTTGAAACTATATTTCTCGAGAAATATAGTTTCAAACCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170753.2-1699s21c1
Sequence:CCGGGATAAGTATCGGGCATCAATCCTCGAGGATTGATGCCCGATACTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170753.2-1156s21c1
Sequence:CCGGCCCATTCGGTTTGGCTATAAGCTCGAGCTTATAGCCAAACCGAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170753
VALIDATED
PGBD3 MISSION shRNA Lentiviral Transduction Particles
piggyBac transposable element derived 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170753.1-2015s1c1
Sequence:CCGGCCGTTGAATATCACACTGAATCTCGAGATTCAGTGTGATATTCAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170753.1-436s1c1
Sequence:CCGGGCTGCGTATCTTATTCAAGATCTCGAGATCTTGAATAAGATACGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170753.1-997s1c1
Sequence:CCGGCCTCTCATAAGCAAACTTAATCTCGAGATTAAGTTTGCTTATGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_170753.1-1879s1c1
Sequence:CCGGCGTAACATTGACTCACGTTATCTCGAGATAACGTGAGTCAATGTTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170753.1-680s1c1
Sequence:CCGGCCACAGAAATTCTTGAACTTTCTCGAGAAAGTTCAAGAATTTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170753.2-946s21c1
Sequence:CCGGGACCGGTTTGAAACTATATTTCTCGAGAAATATAGTTTCAAACCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170753.2-1699s21c1
Sequence:CCGGGATAAGTATCGGGCATCAATCCTCGAGGATTGATGCCCGATACTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170753.2-1156s21c1
Sequence:CCGGCCCATTCGGTTTGGCTATAAGCTCGAGCTTATAGCCAAACCGAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)