EMAIL THIS PAGE TO A FRIEND

PGBD4

piggyBac transposable element derived 4

20 Gene Product Result for
Species: Human PGBD4(161779)
UniProtKB ID: Q96DM1, A1L487, A8K0C6, Q8N9E8
Gene ID:
Human(161779) Summary: The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152595 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106801 MISSION® esiRNA targeting human PGBD4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152595 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102345 predicted 1388
2 SASI_Hs01_00102346 predicted 1370
3 SASI_Hs02_00366436 predicted 1277
4 SASI_Hs01_00102347 predicted 1529
5 SASI_Hs01_00102348 predicted 1599
6 SASI_Hs01_00102349 predicted 1011
7 SASI_Hs01_00102350 predicted 1403
8 SASI_Hs02_00366437 predicted 1176
9 SASI_Hs02_00366438 predicted 1280
10 SASI_Hs01_00102354 predicted 1097
11 SASI_Hs01_00102351 predicted 1647
12 SASI_Hs01_00102352 predicted 1666
13 SASI_Hs01_00102353 predicted 1910
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152595
PGBD4 MISSION shRNA Bacterial Glycerol Stock
piggyBac transposable element derived 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152595.4-1713s21c1
Sequence:CCGGACGTGTCATTGTGGATTATAACTCGAGTTATAATCCACAATGACACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152595.4-1890s21c1
Sequence:CCGGGCACACGATGAGCCATATAAACTCGAGTTTATATGGCTCATCGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152595.4-1749s21c1
Sequence:CCGGAGTGGACTCGGCTGATCAAATCTCGAGATTTGATCAGCCGAGTCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-692s1c1
Sequence:CCGGCGTGCTATGATTCCACGTCAACTCGAGTTGACGTGGAATCATAGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1117s1c1
Sequence:CCGGCCAGATTTCATTGCAGAAGATCTCGAGATCTTCTGCAATGAAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1349s1c1
Sequence:CCGGCCTGGCATGAATTTGAAAGATCTCGAGATCTTTCAAATTCATGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-515s1c1
Sequence:CCGGGAACAGTTGTTGGCTGAAGATCTCGAGATCTTCAGCCAACAACTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1234s1c1
Sequence:CCGGGCCATTAGCTATGAAGCAGTACTCGAGTACTGCTTCATAGCTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-587s1c1
Sequence:CCGGGATAGTGCTTTAGAAGCCGATCTCGAGATCGGCTTCTAAAGCACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1917s1c1
Sequence:CCGGGACTGGCATTGATTGAAAGAACTCGAGTTCTTTCAATCAATGCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152595
PGBD4 MISSION shRNA shRNA Plasmid DNA
piggyBac transposable element derived 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152595.4-1713s21c1
Sequence:CCGGACGTGTCATTGTGGATTATAACTCGAGTTATAATCCACAATGACACGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000416705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152595.4-1890s21c1
Sequence:CCGGGCACACGATGAGCCATATAAACTCGAGTTTATATGGCTCATCGTGTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000413520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152595.4-1749s21c1
Sequence:CCGGAGTGGACTCGGCTGATCAAATCTCGAGATTTGATCAGCCGAGTCCACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000136825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-692s1c1
Sequence:CCGGCGTGCTATGATTCCACGTCAACTCGAGTTGACGTGGAATCATAGCACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000133883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1117s1c1
Sequence:CCGGCCAGATTTCATTGCAGAAGATCTCGAGATCTTCTGCAATGAAATCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000134002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1349s1c1
Sequence:CCGGCCTGGCATGAATTTGAAAGATCTCGAGATCTTTCAAATTCATGCCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000135497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-515s1c1
Sequence:CCGGGAACAGTTGTTGGCTGAAGATCTCGAGATCTTCAGCCAACAACTGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000135367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1234s1c1
Sequence:CCGGGCCATTAGCTATGAAGCAGTACTCGAGTACTGCTTCATAGCTAATGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000136163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-587s1c1
Sequence:CCGGGATAGTGCTTTAGAAGCCGATCTCGAGATCGGCTTCTAAAGCACTATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000134298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1917s1c1
Sequence:CCGGGACTGGCATTGATTGAAAGAACTCGAGTTCTTTCAATCAATGCCAGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152595
PGBD4 MISSION shRNA Lentiviral Transduction Particles
piggyBac transposable element derived 4
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000427457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152595.4-1713s21c1
Sequence:CCGGACGTGTCATTGTGGATTATAACTCGAGTTATAATCCACAATGACACGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152595.4-1890s21c1
Sequence:CCGGGCACACGATGAGCCATATAAACTCGAGTTTATATGGCTCATCGTGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152595.4-1749s21c1
Sequence:CCGGAGTGGACTCGGCTGATCAAATCTCGAGATTTGATCAGCCGAGTCCACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-692s1c1
Sequence:CCGGCGTGCTATGATTCCACGTCAACTCGAGTTGACGTGGAATCATAGCACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1117s1c1
Sequence:CCGGCCAGATTTCATTGCAGAAGATCTCGAGATCTTCTGCAATGAAATCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1349s1c1
Sequence:CCGGCCTGGCATGAATTTGAAAGATCTCGAGATCTTTCAAATTCATGCCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-515s1c1
Sequence:CCGGGAACAGTTGTTGGCTGAAGATCTCGAGATCTTCAGCCAACAACTGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1234s1c1
Sequence:CCGGGCCATTAGCTATGAAGCAGTACTCGAGTACTGCTTCATAGCTAATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-587s1c1
Sequence:CCGGGATAGTGCTTTAGAAGCCGATCTCGAGATCGGCTTCTAAAGCACTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152595.2-1917s1c1
Sequence:CCGGGACTGGCATTGATTGAAAGAACTCGAGTTCTTTCAATCAATGCCAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)