EMAIL THIS PAGE TO A FRIEND

PGC

progastricsin (pepsinogen C)

53 Gene Product Result for
Synonyms: PEPC PGII
UniProtKB ID: P20142, B4DVZ3, Q5T3D7, Q5T3D8
Gene ID:
Human(5225) Summary: This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Mouse(109820) progastricsin (pepsinogen C)
Rat(24864) progastricsin (pepsinogen C)
cow(514502) progastricsin (pepsinogen C)
sheep(101106633) progastricsin (pepsinogen C)
naked mole-rat(101713573) progastricsin (pepsinogen C)
Domestic Rabbit(100009323) progastricsin (pepsinogen C)
domestic guinea pig(100135598) progastricsin (pepsinogen C)
fruit fly(5740599) polar granule component
domestic cat(101100053) progastricsin (pepsinogen C)
dog(609052) progastricsin (pepsinogen C)
chicken(395690) progastricsin (pepsinogen C)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002630 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125551 MISSION® esiRNA esiRNA human PGC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002630 Rosetta Predictions human pricing
NM_133284 Rosetta Predictions rat pricing
NM_025973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334149 predicted 466
2 SASI_Hs01_00211748 predicted 771
3 SASI_Hs01_00211749 predicted 1094
4 SASI_Hs01_00211750 predicted 965
5 SASI_Hs01_00211751 predicted 558
6 SASI_Hs01_00211752 predicted 968
7 SASI_Hs01_00211753 predicted 417
8 SASI_Hs01_00211754 predicted 679
9 SASI_Hs01_00211755 predicted 1000
10 SASI_Hs01_00211756 predicted 549
11 SASI_Hs01_00211757 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103370 predicted 226
2 SASI_Rn01_00103371 predicted 920
3 SASI_Rn01_00103372 predicted 721
4 SASI_Rn01_00103373 predicted 899
5 SASI_Rn01_00103374 predicted 883
6 SASI_Rn01_00103375 predicted 499
7 SASI_Rn01_00103376 predicted 726
8 SASI_Rn01_00103377 predicted 929
9 SASI_Rn01_00103378 predicted 968
10 SASI_Rn01_00103379 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157757 predicted 819
2 SASI_Mm01_00157758 predicted 416
3 SASI_Mm01_00157759 predicted 500
4 SASI_Mm01_00157760 predicted 525
5 SASI_Mm01_00157761 predicted 238
6 SASI_Mm01_00157762 predicted 811
7 SASI_Mm01_00157763 predicted 928
8 SASI_Mm01_00157764 predicted 542
9 SASI_Mm01_00157765 predicted 485
10 SASI_Mm01_00157766 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002630
PGC MISSION shRNA Bacterial Glycerol Stock
progastricsin (pepsinogen C)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002630.2-116s21c1
Sequence:CCGGCTGAAGAAATTTAAGTCTATCCTCGAGGATAGACTTAAATTTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002630.2-1037s21c1
Sequence:CCGGCTGCCACCTTCCTCCTATATCCTCGAGGATATAGGAGGAAGGTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002630.2-1146s21c1
Sequence:CCGGTCTTCCTCAGGTCCTACTATTCTCGAGAATAGTAGGACCTGAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-184s1c1
Sequence:CCGGCCCACAAGTATGATCCTGCTTCTCGAGAAGCAGGATCATACTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-906s1c1
Sequence:CCGGCAGCAGTACATGAGTGCTCTTCTCGAGAAGAGCACTCATGTACTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-974s1c1
Sequence:CCGGGAACTGTAACAGCATTCAGAACTCGAGTTCTGAATGCTGTTACAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-786s1c1
Sequence:CCGGCAGGAACTCTACTGGCAGATTCTCGAGAATCTGCCAGTAGAGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-549s1c1
Sequence:CCGGCCTGGTACCAACTTCGTCTATCTCGAGATAGACGAAGTTGGTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002630
PGC MISSION shRNA shRNA Plasmid DNA
progastricsin (pepsinogen C)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002630.2-116s21c1
Sequence:CCGGCTGAAGAAATTTAAGTCTATCCTCGAGGATAGACTTAAATTTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002630.2-1037s21c1
Sequence:CCGGCTGCCACCTTCCTCCTATATCCTCGAGGATATAGGAGGAAGGTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002630.2-1146s21c1
Sequence:CCGGTCTTCCTCAGGTCCTACTATTCTCGAGAATAGTAGGACCTGAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-184s1c1
Sequence:CCGGCCCACAAGTATGATCCTGCTTCTCGAGAAGCAGGATCATACTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-906s1c1
Sequence:CCGGCAGCAGTACATGAGTGCTCTTCTCGAGAAGAGCACTCATGTACTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-974s1c1
Sequence:CCGGGAACTGTAACAGCATTCAGAACTCGAGTTCTGAATGCTGTTACAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-786s1c1
Sequence:CCGGCAGGAACTCTACTGGCAGATTCTCGAGAATCTGCCAGTAGAGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-549s1c1
Sequence:CCGGCCTGGTACCAACTTCGTCTATCTCGAGATAGACGAAGTTGGTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002630
PGC MISSION shRNA Lentiviral Transduction Particles
progastricsin (pepsinogen C)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002630.2-116s21c1
Sequence:CCGGCTGAAGAAATTTAAGTCTATCCTCGAGGATAGACTTAAATTTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002630.2-1037s21c1
Sequence:CCGGCTGCCACCTTCCTCCTATATCCTCGAGGATATAGGAGGAAGGTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002630.2-1146s21c1
Sequence:CCGGTCTTCCTCAGGTCCTACTATTCTCGAGAATAGTAGGACCTGAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-184s1c1
Sequence:CCGGCCCACAAGTATGATCCTGCTTCTCGAGAAGCAGGATCATACTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-906s1c1
Sequence:CCGGCAGCAGTACATGAGTGCTCTTCTCGAGAAGAGCACTCATGTACTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-974s1c1
Sequence:CCGGGAACTGTAACAGCATTCAGAACTCGAGTTCTGAATGCTGTTACAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-786s1c1
Sequence:CCGGCAGGAACTCTACTGGCAGATTCTCGAGAATCTGCCAGTAGAGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002630.1-549s1c1
Sequence:CCGGCCTGGTACCAACTTCGTCTATCTCGAGATAGACGAAGTTGGTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025973
PGC MISSION shRNA Bacterial Glycerol Stock
progastricsin (pepsinogen C)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-824s1c1
Sequence:CCGGGCAGATCACCATTGACGACTTCTCGAGAAGTCGTCAATGGTGATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-975s1c1
Sequence:CCGGGAAGGAGAGTATGGACAGTATCTCGAGATACTGTCCATACTCTCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-1194s1c1
Sequence:CCGGGCTGTCTTCGACATGGGCAATCTCGAGATTGCCCATGTCGAAGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-213s1c1
Sequence:CCGGCCTGGCCAGAAATACCACTTTCTCGAGAAAGTGGTATTTCTGGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-251s1c1
Sequence:CCGGCAGTGTACTCTATGAGCCCATCTCGAGATGGGCTCATAGAGTACACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025973
PGC MISSION shRNA shRNA Plasmid DNA
progastricsin (pepsinogen C)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-824s1c1
Sequence:CCGGGCAGATCACCATTGACGACTTCTCGAGAAGTCGTCAATGGTGATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-975s1c1
Sequence:CCGGGAAGGAGAGTATGGACAGTATCTCGAGATACTGTCCATACTCTCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-1194s1c1
Sequence:CCGGGCTGTCTTCGACATGGGCAATCTCGAGATTGCCCATGTCGAAGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-213s1c1
Sequence:CCGGCCTGGCCAGAAATACCACTTTCTCGAGAAAGTGGTATTTCTGGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-251s1c1
Sequence:CCGGCAGTGTACTCTATGAGCCCATCTCGAGATGGGCTCATAGAGTACACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025973
PGC MISSION shRNA Lentiviral Transduction Particles
progastricsin (pepsinogen C)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-824s1c1
Sequence:CCGGGCAGATCACCATTGACGACTTCTCGAGAAGTCGTCAATGGTGATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-975s1c1
Sequence:CCGGGAAGGAGAGTATGGACAGTATCTCGAGATACTGTCCATACTCTCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-1194s1c1
Sequence:CCGGGCTGTCTTCGACATGGGCAATCTCGAGATTGCCCATGTCGAAGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-213s1c1
Sequence:CCGGCCTGGCCAGAAATACCACTTTCTCGAGAAAGTGGTATTTCTGGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025973.2-251s1c1
Sequence:CCGGCAGTGTACTCTATGAGCCCATCTCGAGATGGGCTCATAGAGTACACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)