EMAIL THIS PAGE TO A FRIEND

PGD

phosphogluconate dehydrogenase

92 Gene Product Result for
Synonyms: 6PGD
UniProtKB ID: P52209, A8K2Y9, Q9BWD8
Gene ID:
Human(5226) Summary: 6-phosphogluconate dehydrogenase is the second dehydrogenase in the pentose phosphate shunt. Deficiency of this enzyme is generally asymptomatic, and the inheritance of this disorder is autosomal dominant. Hemolysis results from combined deficiency of 6-phosphogluconate dehydrogenase and 6-phosphogluconolactonase suggesting a synergism of the two enzymopathies. [provided by RefSeq, Jul 2008]
Mouse(110208) phosphogluconate dehydrogenase
Rat(362660) phosphogluconate dehydrogenase
cow(514939) phosphogluconate dehydrogenase
sheep(443541) phosphogluconate dehydrogenase
domestic guinea pig(101788565) phosphogluconate dehydrogenase
Domestic Rabbit(100353441) phosphogluconate dehydrogenase
naked mole-rat(101701691) phosphogluconate dehydrogenase
fruit fly(31185) Phosphogluconate dehydrogenase
domestic cat(101096246) phosphogluconate dehydrogenase
dog(478236) phosphogluconate dehydrogenase
chicken(419450) phosphogluconate dehydrogenase
Zebrafish(406762) phosphogluconate hydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0230 AQUA Peptide GILFVGSGVSGGEEGA[R] bakers yeast, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002631 Rosetta Predictions human pricing
XM_342979 Rosetta Predictions rat pricing
NM_001081274 Rosetta Predictions mouse pricing
XM_001003312 Rosetta Predictions mouse pricing
XM_622094 Rosetta Predictions mouse pricing
XM_902243 Rosetta Predictions mouse pricing
XM_902245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134091 predicted 1194
2 SASI_Hs02_00334150 predicted 949
3 SASI_Hs01_00134092 predicted 1517
4 SASI_Hs01_00134093 predicted 972
5 SASI_Hs01_00134094 predicted 291
6 SASI_Hs01_00134096 predicted 1087
7 SASI_Hs01_00134097 predicted 1123
8 SASI_Hs01_00134098 predicted 1367
9 SASI_Hs01_00134099 predicted 1011
10 SASI_Hs02_00334151 predicted 1058
11 SASI_Hs01_00134090 predicted 387
12 SASI_Hs01_00134095 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162196 predicted 789
2 SASI_Rn01_00162197 predicted 247
3 SASI_Rn01_00162198 predicted 1133
4 SASI_Rn01_00162199 predicted 231
5 SASI_Rn01_00162200 predicted 1056
6 SASI_Rn01_00162201 predicted 323
7 SASI_Rn01_00162202 predicted 1470
8 SASI_Rn01_00162203 predicted 1178
9 SASI_Rn01_00162204 predicted 819
10 SASI_Rn01_00162205 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296867 predicted 1083
2 SASI_Mm02_00296868 predicted 351
3 SASI_Mm02_00296869 predicted 1025
4 SASI_Mm02_00296870 predicted 1535
5 SASI_Mm02_00296871 predicted 703
6 SASI_Mm02_00296872 predicted 1466
7 SASI_Mm02_00296873 predicted 1389
8 SASI_Mm02_00296874 predicted 372
9 SASI_Mm02_00296875 predicted 1168
10 SASI_Mm02_00296876 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280404 predicted 703
2 SASI_Mm01_00280405 predicted 980
3 SASI_Mm01_00280406 predicted 2273
4 SASI_Mm01_00280407 predicted 669
5 SASI_Mm01_00280408 predicted 2007
6 SASI_Mm01_00280409 predicted 1890
7 SASI_Mm01_00280410 predicted 759
8 SASI_Mm01_00280411 predicted 2330
9 SASI_Mm01_00280412 predicted 1020
10 SASI_Mm01_00280413 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210728 predicted 349
2 SASI_Mm01_00210729 predicted 621
3 SASI_Mm01_00210730 predicted 1920
4 SASI_Mm01_00210731 predicted 327
5 SASI_Mm01_00210732 predicted 1536
6 SASI_Mm01_00210733 predicted 414
7 SASI_Mm01_00210734 predicted 1980
8 SASI_Mm01_00210735 predicted 667
9 SASI_Mm01_00210736 predicted 384
10 SASI_Mm01_00210737 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235216 predicted 761
2 SASI_Mm01_00235217 predicted 352
3 SASI_Mm01_00235218 predicted 576
4 SASI_Mm01_00235219 predicted 325
5 SASI_Mm01_00235220 predicted 268
6 SASI_Mm01_00235221 predicted 549
7 SASI_Mm01_00235222 predicted 412
8 SASI_Mm01_00235223 predicted 534
9 SASI_Mm01_00235224 predicted 383
10 SASI_Mm01_00235225 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230396 predicted 359
2 SASI_Mm01_00230397 predicted 323
3 SASI_Mm01_00230398 predicted 409
4 SASI_Mm01_00230399 predicted 263
5 SASI_Mm01_00230400 predicted 458
6 SASI_Mm01_00230401 predicted 381
7 SASI_Mm01_00230402 predicted 293
8 SASI_Mm01_00230403 predicted 412
9 SASI_Mm01_00230404 predicted 271
10 SASI_Mm01_00230405 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002631
VALIDATED
PGD MISSION shRNA Bacterial Glycerol Stock
phosphogluconate dehydrogenase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002631.2-135s1c1
Sequence:CCGGCCAGAACTTAATTCTGAACATCTCGAGATGTTCAGAATTAAGTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002631.2-331s1c1
Sequence:CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002631.2-1020s1c1
Sequence:CCGGCCAGTTTGATGGTGATAAGAACTCGAGTTCTTATCACCATCAAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002631.2-1267s1c1
Sequence:CCGGGACTTCTTTAAGTCAGCTGTTCTCGAGAACAGCTGACTTAAAGAAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002631.2-783s1c1
Sequence:CCGGCCTGATTGAAATCACAGCCAACTCGAGTTGGCTGTGATTTCAATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002631.2-1090s21c1
Sequence:CCGGTCTTACGCTCAAGGCTTTATGCTCGAGCATAAAGCCTTGAGCGTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-1611s21c1
Sequence:CCGGACCTGGCCCTTTGCCCTATTTCTCGAGAAATAGGGCAAAGGGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-1135s21c1
Sequence:CCGGTTTGGCTGGACTCTCAATTATCTCGAGATAATTGAGAGTCCAGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-941s21c1
Sequence:CCGGCTGTCTTTGCTCGGTGCTTATCTCGAGATAAGCACCGAGCAAAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-331s21c1
Sequence:CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002631
VALIDATED
PGD MISSION shRNA shRNA Plasmid DNA
phosphogluconate dehydrogenase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002631.2-135s1c1
Sequence:CCGGCCAGAACTTAATTCTGAACATCTCGAGATGTTCAGAATTAAGTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002631.2-331s1c1
Sequence:CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002631.2-1020s1c1
Sequence:CCGGCCAGTTTGATGGTGATAAGAACTCGAGTTCTTATCACCATCAAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002631.2-1267s1c1
Sequence:CCGGGACTTCTTTAAGTCAGCTGTTCTCGAGAACAGCTGACTTAAAGAAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002631.2-783s1c1
Sequence:CCGGCCTGATTGAAATCACAGCCAACTCGAGTTGGCTGTGATTTCAATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002631.2-1090s21c1
Sequence:CCGGTCTTACGCTCAAGGCTTTATGCTCGAGCATAAAGCCTTGAGCGTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-1611s21c1
Sequence:CCGGACCTGGCCCTTTGCCCTATTTCTCGAGAAATAGGGCAAAGGGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-1135s21c1
Sequence:CCGGTTTGGCTGGACTCTCAATTATCTCGAGATAATTGAGAGTCCAGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-941s21c1
Sequence:CCGGCTGTCTTTGCTCGGTGCTTATCTCGAGATAAGCACCGAGCAAAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-331s21c1
Sequence:CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002631
VALIDATED
PGD MISSION shRNA Lentiviral Transduction Particles
phosphogluconate dehydrogenase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002631.2-135s1c1
Sequence:CCGGCCAGAACTTAATTCTGAACATCTCGAGATGTTCAGAATTAAGTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002631.2-331s1c1
Sequence:CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002631.2-1020s1c1
Sequence:CCGGCCAGTTTGATGGTGATAAGAACTCGAGTTCTTATCACCATCAAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002631.2-1267s1c1
Sequence:CCGGGACTTCTTTAAGTCAGCTGTTCTCGAGAACAGCTGACTTAAAGAAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002631.2-783s1c1
Sequence:CCGGCCTGATTGAAATCACAGCCAACTCGAGTTGGCTGTGATTTCAATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002631.2-1090s21c1
Sequence:CCGGTCTTACGCTCAAGGCTTTATGCTCGAGCATAAAGCCTTGAGCGTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-1611s21c1
Sequence:CCGGACCTGGCCCTTTGCCCTATTTCTCGAGAAATAGGGCAAAGGGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-1135s21c1
Sequence:CCGGTTTGGCTGGACTCTCAATTATCTCGAGATAATTGAGAGTCCAGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-941s21c1
Sequence:CCGGCTGTCTTTGCTCGGTGCTTATCTCGAGATAAGCACCGAGCAAAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002631.2-331s21c1
Sequence:CCGGGTGGATGATTTCATCGAGAAACTCGAGTTTCTCGATGAAATCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025801
PGD MISSION shRNA Bacterial Glycerol Stock
phosphogluconate dehydrogenase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-639s1c1
Sequence:CCGGCGGGATAGAGTATGGAGACATCTCGAGATGTCTCCATACTCTATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-1053s1c1
Sequence:CCGGCCTCTATGCTTCCAAGATCATCTCGAGATGATCTTGGAAGCATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-768s1c1
Sequence:CCGGCCTGATTGAAATCACTGCTAACTCGAGTTAGCAGTGATTTCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-1496s1c1
Sequence:CCGGGCAGTGTGTCATCCTCTTCATCTCGAGATGAAGAGGATGACACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-330s1c1
Sequence:CCGGCGAGAAATTAGTACCCTTGTTCTCGAGAACAAGGGTACTAATTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025801
PGD MISSION shRNA shRNA Plasmid DNA
phosphogluconate dehydrogenase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-639s1c1
Sequence:CCGGCGGGATAGAGTATGGAGACATCTCGAGATGTCTCCATACTCTATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-1053s1c1
Sequence:CCGGCCTCTATGCTTCCAAGATCATCTCGAGATGATCTTGGAAGCATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-768s1c1
Sequence:CCGGCCTGATTGAAATCACTGCTAACTCGAGTTAGCAGTGATTTCAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-1496s1c1
Sequence:CCGGGCAGTGTGTCATCCTCTTCATCTCGAGATGAAGAGGATGACACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-330s1c1
Sequence:CCGGCGAGAAATTAGTACCCTTGTTCTCGAGAACAAGGGTACTAATTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025801
PGD MISSION shRNA Lentiviral Transduction Particles
phosphogluconate dehydrogenase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-639s1c1
Sequence:CCGGCGGGATAGAGTATGGAGACATCTCGAGATGTCTCCATACTCTATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-1053s1c1
Sequence:CCGGCCTCTATGCTTCCAAGATCATCTCGAGATGATCTTGGAAGCATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-768s1c1
Sequence:CCGGCCTGATTGAAATCACTGCTAACTCGAGTTAGCAGTGATTTCAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-1496s1c1
Sequence:CCGGGCAGTGTGTCATCCTCTTCATCTCGAGATGAAGAGGATGACACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025801.1-330s1c1
Sequence:CCGGCGAGAAATTAGTACCCTTGTTCTCGAGAACAAGGGTACTAATTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081274
PGD MISSION shRNA Bacterial Glycerol Stock
phosphogluconate dehydrogenase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-1534s21c1
Sequence:CCGGGCAGTGTGTCATCCTCTTCATCTCGAGATGAAGAGGATGACACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-1091s21c1
Sequence:CCGGCCTCTATGCTTCCAAGATCATCTCGAGATGATCTTGGAAGCATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-677s21c1
Sequence:CCGGCGGGATAGAGTATGGAGACATCTCGAGATGTCTCCATACTCTATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-368s21c1
Sequence:CCGGCGAGAAATTAGTACCCTTGTTCTCGAGAACAAGGGTACTAATTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-806s21c1
Sequence:CCGGCCTGATTGAAATCACTGCTAACTCGAGTTAGCAGTGATTTCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081274
PGD MISSION shRNA shRNA Plasmid DNA
phosphogluconate dehydrogenase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-1534s21c1
Sequence:CCGGGCAGTGTGTCATCCTCTTCATCTCGAGATGAAGAGGATGACACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-1091s21c1
Sequence:CCGGCCTCTATGCTTCCAAGATCATCTCGAGATGATCTTGGAAGCATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-677s21c1
Sequence:CCGGCGGGATAGAGTATGGAGACATCTCGAGATGTCTCCATACTCTATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-368s21c1
Sequence:CCGGCGAGAAATTAGTACCCTTGTTCTCGAGAACAAGGGTACTAATTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-806s21c1
Sequence:CCGGCCTGATTGAAATCACTGCTAACTCGAGTTAGCAGTGATTTCAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081274
PGD MISSION shRNA Lentiviral Transduction Particles
phosphogluconate dehydrogenase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-1534s21c1
Sequence:CCGGGCAGTGTGTCATCCTCTTCATCTCGAGATGAAGAGGATGACACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-1091s21c1
Sequence:CCGGCCTCTATGCTTCCAAGATCATCTCGAGATGATCTTGGAAGCATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-677s21c1
Sequence:CCGGCGGGATAGAGTATGGAGACATCTCGAGATGTCTCCATACTCTATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-368s21c1
Sequence:CCGGCGAGAAATTAGTACCCTTGTTCTCGAGAACAAGGGTACTAATTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081274.1-806s21c1
Sequence:CCGGCCTGATTGAAATCACTGCTAACTCGAGTTAGCAGTGATTTCAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)