EMAIL THIS PAGE TO A FRIEND

PGF

placental growth factor

71 Gene Product Result for
Synonyms: D12S1900 PGFL PLGF PlGF-2 SHGC-10760
UniProtKB ID: P49763, Q07101, Q9BV78, Q9Y6S8
Gene ID:
Human(5228) Summary: This gene encodes a growth factor found in placenta which is homologous to vascular endothelial growth factor. Alternatively spliced transcripts encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
Mouse(18654) placental growth factor
Rat(94203) placental growth factor
chicken(771832) placental growth factor
dog(611916) placental growth factor
domestic cat(101095904) placental growth factor
naked mole-rat(101725085) placental growth factor
domestic guinea pig(100734450) placental growth factor
cow(280894) placental growth factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002632 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002632 Rosetta Predictions human pricing
NM_053595 Rosetta Predictions rat pricing
NM_008827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174339 predicted 646
2 SASI_Hs01_00174341 predicted 351
3 SASI_Hs01_00174342 predicted 1031
4 SASI_Hs02_00334152 predicted 949
5 SASI_Hs01_00174343 predicted 628
6 SASI_Hs01_00174344 predicted 1004
7 SASI_Hs01_00174345 predicted 945
8 SASI_Hs01_00174346 predicted 701
9 SASI_Hs01_00174347 predicted 971
10 SASI_Hs01_00174348 predicted 887
11 SASI_Hs01_00174340 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110652 predicted 870
2 SASI_Rn01_00110653 predicted 825
3 SASI_Rn01_00110654 predicted 586
4 SASI_Rn01_00110655 predicted 1227
5 SASI_Rn01_00110656 predicted 447
6 SASI_Rn02_00266273 predicted 599
7 SASI_Rn01_00110658 predicted 574
8 SASI_Rn01_00110660 predicted 483
9 SASI_Rn01_00110661 predicted 1062
10 SASI_Rn02_00266274 predicted 440
11 SASI_Rn01_00110657 predicted 559
12 SASI_Rn01_00110659 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167630 predicted 706
2 SASI_Mm02_00314762 predicted 596
3 SASI_Mm01_00167631 predicted 897
4 SASI_Mm02_00314763 predicted 887
5 SASI_Mm01_00167633 predicted 1269
6 SASI_Mm01_00167635 predicted 590
7 SASI_Mm01_00167636 predicted 676
8 SASI_Mm01_00167637 predicted 1284
9 SASI_Mm01_00167638 predicted 693
10 SASI_Mm01_00167639 predicted 498
11 SASI_Mm01_00167632 predicted 481
12 SASI_Mm01_00167634 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002632
VALIDATED
PGF MISSION shRNA Bacterial Glycerol Stock
placental growth factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-555s21c1
Sequence:CCGGAGCACATGTTCAGCCCATCCTCTCGAGAGGATGGGCTGAACATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002632.4-1241s21c1
Sequence:CCGGTTCGGAGCTCCTGTCCAAAGTCTCGAGACTTTGGACAGGAGCTCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-800s21c1
Sequence:CCGGAGAGAGAAGCAGAGACCCACACTCGAGTGTGGGTCTCTGCTTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-692s21c1
Sequence:CCGGTCCTACGTGGAGCTGACGTTCCTCGAGGAACGTCAGCTCCACGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-657s21c1
Sequence:CCGGTGCAGCTCCTAAAGATCCGTTCTCGAGAACGGATCTTTAGGAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002632.3-649s1c1
Sequence:CCGGTGTCACCATGCAGCTCCTAAACTCGAGTTTAGGAGCTGCATGGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002632.3-657s1c1
Sequence:CCGGTGCAGCTCCTAAAGATCCGTTCTCGAGAACGGATCTTTAGGAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002632.3-610s1c1
Sequence:CCGGCGATGAGAATCTGCACTGTGTCTCGAGACACAGTGCAGATTCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002632.3-714s1c1
Sequence:CCGGCTCAGCACGTTCGCTGCGAATCTCGAGATTCGCAGCGAACGTGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002632
VALIDATED
PGF MISSION shRNA shRNA Plasmid DNA
placental growth factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-555s21c1
Sequence:CCGGAGCACATGTTCAGCCCATCCTCTCGAGAGGATGGGCTGAACATGTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002632.4-1241s21c1
Sequence:CCGGTTCGGAGCTCCTGTCCAAAGTCTCGAGACTTTGGACAGGAGCTCCGAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000296379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-800s21c1
Sequence:CCGGAGAGAGAAGCAGAGACCCACACTCGAGTGTGGGTCTCTGCTTCTCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000308204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-692s21c1
Sequence:CCGGTCCTACGTGGAGCTGACGTTCCTCGAGGAACGTCAGCTCCACGTAGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000289713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-657s21c1
Sequence:CCGGTGCAGCTCCTAAAGATCCGTTCTCGAGAACGGATCTTTAGGAGCTGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000058242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002632.3-649s1c1
Sequence:CCGGTGTCACCATGCAGCTCCTAAACTCGAGTTTAGGAGCTGCATGGTGACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000058238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002632.3-657s1c1
Sequence:CCGGTGCAGCTCCTAAAGATCCGTTCTCGAGAACGGATCTTTAGGAGCTGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000058239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002632.3-610s1c1
Sequence:CCGGCGATGAGAATCTGCACTGTGTCTCGAGACACAGTGCAGATTCTCATCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000058240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002632.3-714s1c1
Sequence:CCGGCTCAGCACGTTCGCTGCGAATCTCGAGATTCGCAGCGAACGTGCTGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002632
VALIDATED
PGF MISSION shRNA Lentiviral Transduction Particles
placental growth factor
Human
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000296378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-555s21c1
Sequence:CCGGAGCACATGTTCAGCCCATCCTCTCGAGAGGATGGGCTGAACATGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002632.4-1241s21c1
Sequence:CCGGTTCGGAGCTCCTGTCCAAAGTCTCGAGACTTTGGACAGGAGCTCCGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-800s21c1
Sequence:CCGGAGAGAGAAGCAGAGACCCACACTCGAGTGTGGGTCTCTGCTTCTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-692s21c1
Sequence:CCGGTCCTACGTGGAGCTGACGTTCCTCGAGGAACGTCAGCTCCACGTAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002632.4-657s21c1
Sequence:CCGGTGCAGCTCCTAAAGATCCGTTCTCGAGAACGGATCTTTAGGAGCTGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002632.3-649s1c1
Sequence:CCGGTGTCACCATGCAGCTCCTAAACTCGAGTTTAGGAGCTGCATGGTGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002632.3-657s1c1
Sequence:CCGGTGCAGCTCCTAAAGATCCGTTCTCGAGAACGGATCTTTAGGAGCTGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002632.3-610s1c1
Sequence:CCGGCGATGAGAATCTGCACTGTGTCTCGAGACACAGTGCAGATTCTCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002632.3-714s1c1
Sequence:CCGGCTCAGCACGTTCGCTGCGAATCTCGAGATTCGCAGCGAACGTGCTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008827
PGF MISSION shRNA Bacterial Glycerol Stock
placental growth factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-482s1c1
Sequence:CCGGCTGGTGTACATCTTGGATGAACTCGAGTTCATCCAAGATGTACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-401s1c1
Sequence:CCGGGCTGGGAACAACTCAACAGAACTCGAGTTCTGTTGAGTTGTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-692s1c1
Sequence:CCGGCTCTGTGAATGCAGACCTATTCTCGAGAATAGGTCTGCATTCACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-595s1c1
Sequence:CCGGGCCGATAAAGACAGCCAACATCTCGAGATGTTGGCTGTCTTTATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-652s1c1
Sequence:CCGGTCCACATTTCTATGTGGAGATCTCGAGATCTCCACATAGAAATGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008827
PGF MISSION shRNA shRNA Plasmid DNA
placental growth factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-482s1c1
Sequence:CCGGCTGGTGTACATCTTGGATGAACTCGAGTTCATCCAAGATGTACACCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-401s1c1
Sequence:CCGGGCTGGGAACAACTCAACAGAACTCGAGTTCTGTTGAGTTGTTCCCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-692s1c1
Sequence:CCGGCTCTGTGAATGCAGACCTATTCTCGAGAATAGGTCTGCATTCACAGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-595s1c1
Sequence:CCGGGCCGATAAAGACAGCCAACATCTCGAGATGTTGGCTGTCTTTATCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-652s1c1
Sequence:CCGGTCCACATTTCTATGTGGAGATCTCGAGATCTCCACATAGAAATGTGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008827
PGF MISSION shRNA Lentiviral Transduction Particles
placental growth factor
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000065846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-482s1c1
Sequence:CCGGCTGGTGTACATCTTGGATGAACTCGAGTTCATCCAAGATGTACACCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-401s1c1
Sequence:CCGGGCTGGGAACAACTCAACAGAACTCGAGTTCTGTTGAGTTGTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-692s1c1
Sequence:CCGGCTCTGTGAATGCAGACCTATTCTCGAGAATAGGTCTGCATTCACAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-595s1c1
Sequence:CCGGGCCGATAAAGACAGCCAACATCTCGAGATGTTGGCTGTCTTTATCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008827.2-652s1c1
Sequence:CCGGTCCACATTTCTATGTGGAGATCTCGAGATCTCCACATAGAAATGTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)