EMAIL THIS PAGE TO A FRIEND

PGGT1B

protein geranylgeranyltransferase type I, beta subunit

80 Gene Product Result for
Synonyms: BGGI GGTI
UniProtKB ID: P53609, Q5MJP9
Gene ID:
Human(5229) Summary: Protein geranylgeranyltransferase type I (GGTase-I) transfers a geranylgeranyl group to the cysteine residue of candidate proteins containing a C-terminal CAAX motif in which 'A' is an aliphatic amino acid and 'X' is leucine (summarized by Zhang et al., 1994 [PubMed 8106351]
Mouse(225467) protein geranylgeranyltransferase type I, beta subunit
Rat(81746) protein geranylgeranyltransferase type I, beta subunit
Zebrafish(570808) protein geranylgeranyltransferase type I, beta subunit
chicken(770633) protein geranylgeranyltransferase type I, beta subunit
domestic cat(101089829) protein geranylgeranyltransferase type I, beta subunit
dog(481440) protein geranylgeranyltransferase type I, beta subunit
cow(509322) protein geranylgeranyltransferase type I, beta subunit
sheep(101123045) protein geranylgeranyltransferase type I, beta subunit
domestic guinea pig(100735292) protein geranylgeranyltransferase type I, beta subunit
naked mole-rat(101723510) protein geranylgeranyltransferase type I, beta subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA030646 Anti-PGGT1B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0005229M2 Monoclonal Anti-PGGT1B antibody produced in mouse clone 5E4, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005023 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005023 Rosetta Predictions human pricing
NM_031082 Rosetta Predictions rat pricing
NM_172627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148082 predicted 273
2 SASI_Hs01_00148083 predicted 320
3 SASI_Hs01_00148084 predicted 1140
4 SASI_Hs01_00148085 predicted 790
5 SASI_Hs01_00148086 predicted 1009
6 SASI_Hs02_00338796 predicted 1070
7 SASI_Hs01_00148089 predicted 603
8 SASI_Hs01_00148090 predicted 1048
9 SASI_Hs02_00338797 predicted 377
10 SASI_Hs02_00338798 predicted 403
11 SASI_Hs01_00148087 predicted 521
12 SASI_Hs01_00148088 predicted 396
13 SASI_Hs01_00148091 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078559 predicted 305
2 SASI_Rn02_00264322 predicted 316
3 SASI_Rn01_00078560 predicted 303
4 SASI_Rn01_00078561 predicted 1200
5 SASI_Rn01_00078562 predicted 416
6 SASI_Rn01_00078563 predicted 997
7 SASI_Rn01_00078564 predicted 227
8 SASI_Rn01_00078565 predicted 743
9 SASI_Rn01_00078566 predicted 732
10 SASI_Rn01_00078567 predicted 1162
11 SASI_Rn01_00078568 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028044 predicted 755
2 SASI_Mm01_00028045 predicted 252
3 SASI_Mm02_00344333 predicted 727
4 SASI_Mm01_00028046 predicted 1146
5 SASI_Mm01_00028047 predicted 1222
6 SASI_Mm01_00028048 predicted 615
7 SASI_Mm01_00028049 predicted 1053
8 SASI_Mm01_00028050 predicted 1121
9 SASI_Mm01_00028051 predicted 764
10 SASI_Mm01_00028052 predicted 437
11 SASI_Mm01_00028043 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172627
VALIDATED
PGGT1B MISSION shRNA Bacterial Glycerol Stock
protein geranylgeranyltransferase type I, beta subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172627.3-378s21c1
Sequence:CCGGCTTACGACAGTGGACACATAGCTCGAGCTATGTGTCCACTGTCGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-717s21c1
Sequence:CCGGCACTGTGCCTGATGGGTAAACCTCGAGGTTTACCCATCAGGCACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172627.1-770s1c1
Sequence:CCGGCAGGATAAAGAGGTGGTGCATCTCGAGATGCACCACCTCTTTATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-561s21c1
Sequence:CCGGGCGCATCCTGCATTTGCTATACTCGAGTATAGCAAATGCAGGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-228s21c1
Sequence:CCGGTGGTGAACAAAGACGATATAACTCGAGTTATATCGTCTTTGTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172627.1-378s1c1
Sequence:CCGGCCTTACGACAGTGGACACATACTCGAGTATGTGTCCACTGTCGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172627.1-1939s1c1
Sequence:CCGGCGCTCTCTAGAGAAAGACATTCTCGAGAATGTCTTTCTCTAGAGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172627.3-910s1c1
Sequence:CCGGGAATAGGAACTACATCTTATCCTCGAGGATAAGATGTAGTTCCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-1424s21c1
Sequence:CCGGGACTATATGTTTGTAGGTTATCTCGAGATAACCTACAAACATATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172627
VALIDATED
PGGT1B MISSION shRNA shRNA Plasmid DNA
protein geranylgeranyltransferase type I, beta subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172627.3-378s21c1
Sequence:CCGGCTTACGACAGTGGACACATAGCTCGAGCTATGTGTCCACTGTCGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-717s21c1
Sequence:CCGGCACTGTGCCTGATGGGTAAACCTCGAGGTTTACCCATCAGGCACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172627.1-770s1c1
Sequence:CCGGCAGGATAAAGAGGTGGTGCATCTCGAGATGCACCACCTCTTTATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-561s21c1
Sequence:CCGGGCGCATCCTGCATTTGCTATACTCGAGTATAGCAAATGCAGGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-228s21c1
Sequence:CCGGTGGTGAACAAAGACGATATAACTCGAGTTATATCGTCTTTGTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172627.1-378s1c1
Sequence:CCGGCCTTACGACAGTGGACACATACTCGAGTATGTGTCCACTGTCGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172627.1-1939s1c1
Sequence:CCGGCGCTCTCTAGAGAAAGACATTCTCGAGAATGTCTTTCTCTAGAGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172627.3-910s1c1
Sequence:CCGGGAATAGGAACTACATCTTATCCTCGAGGATAAGATGTAGTTCCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-1424s21c1
Sequence:CCGGGACTATATGTTTGTAGGTTATCTCGAGATAACCTACAAACATATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172627
VALIDATED
PGGT1B MISSION shRNA Lentiviral Transduction Particles
protein geranylgeranyltransferase type I, beta subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172627.3-378s21c1
Sequence:CCGGCTTACGACAGTGGACACATAGCTCGAGCTATGTGTCCACTGTCGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-717s21c1
Sequence:CCGGCACTGTGCCTGATGGGTAAACCTCGAGGTTTACCCATCAGGCACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172627.1-770s1c1
Sequence:CCGGCAGGATAAAGAGGTGGTGCATCTCGAGATGCACCACCTCTTTATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-561s21c1
Sequence:CCGGGCGCATCCTGCATTTGCTATACTCGAGTATAGCAAATGCAGGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-228s21c1
Sequence:CCGGTGGTGAACAAAGACGATATAACTCGAGTTATATCGTCTTTGTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172627.1-378s1c1
Sequence:CCGGCCTTACGACAGTGGACACATACTCGAGTATGTGTCCACTGTCGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172627.1-1939s1c1
Sequence:CCGGCGCTCTCTAGAGAAAGACATTCTCGAGAATGTCTTTCTCTAGAGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172627.3-910s1c1
Sequence:CCGGGAATAGGAACTACATCTTATCCTCGAGGATAAGATGTAGTTCCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172627.3-1424s21c1
Sequence:CCGGGACTATATGTTTGTAGGTTATCTCGAGATAACCTACAAACATATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005023
VALIDATED
PGGT1B MISSION shRNA Bacterial Glycerol Stock
protein geranylgeranyltransferase type I, beta subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005023.3-218s21c1
Sequence:CCGGTGGTGAACAAAGATGATATAACTCGAGTTATATCATCTTTGTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005023.3-798s21c1
Sequence:CCGGTTATCATGGAAGACCTAATAACTCGAGTTATTAGGTCTTCCATGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005023.3-761s21c1
Sequence:CCGGGGATAAAGAGGTGGTGTATAACTCGAGTTATACACCACCTCTTTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005023.2-860s1c1
Sequence:CCGGCCAATACACTAACTTTGAGAACTCGAGTTCTCAAAGTTAGTGTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005023.2-1172s1c1
Sequence:CCGGGCATAACTGTAGCTCAAGTTTCTCGAGAAACTTGAGCTACAGTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005023.2-411s1c1
Sequence:CCGGGACGACTTAAGCCGAGTAAATCTCGAGATTTACTCGGCTTAAGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005023.2-985s1c1
Sequence:CCGGGCCTGTCACTAATGGAGGAAACTCGAGTTTCCTCCATTAGTGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005023.3-1191s21c1
Sequence:CCGGCATAACTGTAGCTCAAGTTTACTCGAGTAAACTTGAGCTACAGTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005023.3-429s21c1
Sequence:CCGGAGACGACTTAAGCCGAGTAAACTCGAGTTTACTCGGCTTAAGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005023
VALIDATED
PGGT1B MISSION shRNA shRNA Plasmid DNA
protein geranylgeranyltransferase type I, beta subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005023.3-218s21c1
Sequence:CCGGTGGTGAACAAAGATGATATAACTCGAGTTATATCATCTTTGTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005023.3-798s21c1
Sequence:CCGGTTATCATGGAAGACCTAATAACTCGAGTTATTAGGTCTTCCATGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005023.3-761s21c1
Sequence:CCGGGGATAAAGAGGTGGTGTATAACTCGAGTTATACACCACCTCTTTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005023.2-860s1c1
Sequence:CCGGCCAATACACTAACTTTGAGAACTCGAGTTCTCAAAGTTAGTGTATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005023.2-1172s1c1
Sequence:CCGGGCATAACTGTAGCTCAAGTTTCTCGAGAAACTTGAGCTACAGTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005023.2-411s1c1
Sequence:CCGGGACGACTTAAGCCGAGTAAATCTCGAGATTTACTCGGCTTAAGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005023.2-985s1c1
Sequence:CCGGGCCTGTCACTAATGGAGGAAACTCGAGTTTCCTCCATTAGTGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005023.3-1191s21c1
Sequence:CCGGCATAACTGTAGCTCAAGTTTACTCGAGTAAACTTGAGCTACAGTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005023.3-429s21c1
Sequence:CCGGAGACGACTTAAGCCGAGTAAACTCGAGTTTACTCGGCTTAAGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005023
VALIDATED
PGGT1B MISSION shRNA Lentiviral Transduction Particles
protein geranylgeranyltransferase type I, beta subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005023.3-218s21c1
Sequence:CCGGTGGTGAACAAAGATGATATAACTCGAGTTATATCATCTTTGTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005023.3-798s21c1
Sequence:CCGGTTATCATGGAAGACCTAATAACTCGAGTTATTAGGTCTTCCATGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005023.3-761s21c1
Sequence:CCGGGGATAAAGAGGTGGTGTATAACTCGAGTTATACACCACCTCTTTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005023.2-860s1c1
Sequence:CCGGCCAATACACTAACTTTGAGAACTCGAGTTCTCAAAGTTAGTGTATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005023.2-1172s1c1
Sequence:CCGGGCATAACTGTAGCTCAAGTTTCTCGAGAAACTTGAGCTACAGTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005023.2-411s1c1
Sequence:CCGGGACGACTTAAGCCGAGTAAATCTCGAGATTTACTCGGCTTAAGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005023.2-985s1c1
Sequence:CCGGGCCTGTCACTAATGGAGGAAACTCGAGTTTCCTCCATTAGTGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005023.3-1191s21c1
Sequence:CCGGCATAACTGTAGCTCAAGTTTACTCGAGTAAACTTGAGCTACAGTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005023.3-429s21c1
Sequence:CCGGAGACGACTTAAGCCGAGTAAACTCGAGTTTACTCGGCTTAAGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)