PGK1

phosphoglycerate kinase 1

91 Gene Product Result for

Synonyms: MIG10 PGKA

Species: Human PGK1(5230), Mouse Pgk1(18655), Rat Pgk1(24644), Thale Cress PGK1(820461), dog PGK1(480964), domestic cat PGK1(101087208), chicken PGK1(395833), Zebrafish pgk1(406696), cow PGK1(507476), sheep PGK1(100216440), naked mole-rat Pgk1(101714377), domestic guinea pig Pgk1(100722820)

UniProtKB ID: P00558, A8K4W6, Q5J7W1, Q6IBT6, Q8NI87

Gene ID:

Human(5230) Summary: The protein encoded by this gene is a glycolytic enzyme that catalyzes the conversion of 1,3-diphosphoglycerate to 3-phosphoglycerate. The encoded protein may also act as a cofactor for polymerase alpha. This gene lies on the X-chromosome, while a related pseudogene also has been found on the X-chromosome and another on chromosome 19. [provided by RefSeq, Oct 2008]

Mouse(18655) phosphoglycerate kinase 1

Rat(24644) phosphoglycerate kinase 1

Thale Cress(820461) phosphoglycerate kinase 1

dog(480964) phosphoglycerate kinase 1

domestic cat(101087208) phosphoglycerate kinase 1

chicken(395833) phosphoglycerate kinase 1

Zebrafish(406696) phosphoglycerate kinase 1

cow(507476) phosphoglycerate kinase 1

sheep(100216440) phosphoglycerate kinase 1

naked mole-rat(101714377) phosphoglycerate kinase 1

domestic guinea pig(100722820) phosphoglycerate kinase 1

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

AV48140	Anti-PGK1 (AB1) antibody produced in rabbit affinity isolated antibody	human, rat, mouse, bovine, guinea pig, dog, rabbit, horse, sheep	western blot	pricing

AV48141	Anti-PGK1 (AB2) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder	rabbit, canine, horse, human, rat, mouse, pig, bovine, zebrafish	immunohistochemistry, western blot	pricing

SAB1300102	Anti-PGK1 (center S320) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution	human	ELISA, immunohistochemistry, western blot	pricing

ABS787	Anti-PGK1 Antibody (Center) from rabbit	human, mouse	immunocytochemistry, immunohistochemistry, western blot	pricing

HPA045385	Anti-PGK1 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

SAB1402307	Monoclonal Anti-PGK1, (C-terminal) antibody produced in mouse clone 2H4, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR07566	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, PGK1	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_000291	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_000291	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_000291	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_008828	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_008828	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_008828	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU105941	MISSION^® esiRNA targeting human PGK1	human	pricing

EMU185321	MISSION^® esiRNA targeting mouse Pgk1	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_000291	siRNAs that have been validated in the lab	human	pricing
NM_053291	Rosetta Predictions	rat	pricing
NM_008828	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_000291	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_WI_00000014 validated	2190
1	SASI_WI_00000013 validated	1604
2	SASI_Hs01_00176820 predicted	819
3	SASI_Hs01_00176824 predicted	712
4	SASI_Hs02_00302253 predicted	286
5	SASI_Hs02_00302254 predicted	988
6	SASI_Hs02_00302255 predicted	1125
7	SASI_Hs02_00302256 predicted	1228
8	SASI_Hs02_00302257 predicted	1159
9	SASI_Hs02_00302258 predicted	1122
10	SASI_Hs02_00302259 predicted	301
11	SASI_Hs02_00302260 predicted	978
12	SASI_Hs01_00176821 predicted	725
13	SASI_Hs01_00176822 predicted	706
14	SASI_Hs01_00176823 predicted	305
15	SASI_Hs01_00176825 predicted	601
16	SASI_Hs01_00176826 predicted	206
17	SASI_Hs01_00176827 predicted	491
18	SASI_Hs01_00176828 predicted	310
19	SASI_Hs01_00176829 predicted	724

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_053291	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00265653 predicted	953
2	SASI_Rn02_00265654 predicted	531
3	SASI_Rn02_00265655 predicted	523
4	SASI_Rn02_00265656 predicted	648
5	SASI_Rn01_00033791 predicted	276
6	SASI_Rn01_00033793 predicted	229
7	SASI_Rn02_00265657 predicted	1021
8	SASI_Rn01_00033794 predicted	419
9	SASI_Rn02_00265658 predicted	576
10	SASI_Rn01_00033795 predicted	221
11	SASI_Rn01_00033792 predicted	428
12	SASI_Rn01_00033796 predicted	381
13	SASI_Rn01_00033797 predicted	970
14	SASI_Rn01_00033798 predicted	508

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_008828	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00039218 predicted	887
2	SASI_Mm01_00039219 predicted	652
3	SASI_Mm01_00039220 predicted	772
4	SASI_Mm01_00039221 predicted	257
5	SASI_Mm01_00039223 predicted	265
6	SASI_Mm01_00039224 predicted	1116
7	SASI_Mm01_00039225 predicted	745
8	SASI_Mm01_00039226 predicted	704
9	SASI_Mm01_00039227 predicted	587
10	SASI_Mm02_00314764 predicted	346
11	SASI_Mm01_00039222 predicted	1078

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_000291 VALIDATED	PGK1 MISSION shRNA Bacterial Glycerol Stock phosphoglycerate kinase 1	Human

15 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000342769
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-959s21c1
	Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196810
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-338s1c1
	Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195247
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-935s1c1
	Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196454
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-313s1c1
	Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000197075
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-1068s1c1
	Sequence:CCGGGATTGTGTGGAATGGTCCTGTCTCGAGACAGGACCATTCCACACAATCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342701
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-1038s21c1
	Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342698
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-416s21c1
	Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342699
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-441s21c1
	Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195079
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000291.2-1212s1c1
	Sequence:CCGGCAAATGGAACACGGAGGATAACTCGAGTTATCCTCCGTGTTCCATTTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006178
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000291.2-1917s1c1
	Sequence:CCGGGCCTACTTTATGGCAGACATTCTCGAGAATGTCTGCCATAAAGTAGGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006182
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-151s1c1
	Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006179
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000291.2-201s1c1
	Sequence:CCGGCCCAAGCATCAAATTCTGCTTCTCGAGAAGCAGAATTTGATGCTTGGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006180
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-856s1c1
	Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006181
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000291.2-708s1c1
	Sequence:CCGGCGGAGCTAAAGTTGCAGACAACTCGAGTTGTCTGCAACTTTAGCTCCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342767
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-254s21c1
	Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_000291 VALIDATED	PGK1 MISSION shRNA shRNA Plasmid DNA phosphoglycerate kinase 1	Human

15 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000342769
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-959s21c1
	Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196810
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-338s1c1
	Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195247
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-935s1c1
	Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196454
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-313s1c1
	Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000197075
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-1068s1c1
	Sequence:CCGGGATTGTGTGGAATGGTCCTGTCTCGAGACAGGACCATTCCACACAATCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000342701
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-1038s21c1
	Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000342698
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-416s21c1
	Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000342699
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-441s21c1
	Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195079
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000291.2-1212s1c1
	Sequence:CCGGCAAATGGAACACGGAGGATAACTCGAGTTATCCTCCGTGTTCCATTTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000006178
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000291.2-1917s1c1
	Sequence:CCGGGCCTACTTTATGGCAGACATTCTCGAGAATGTCTGCCATAAAGTAGGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000006182
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-151s1c1
	Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000006179
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000291.2-201s1c1
	Sequence:CCGGCCCAAGCATCAAATTCTGCTTCTCGAGAAGCAGAATTTGATGCTTGGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000006180
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-856s1c1
	Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000006181
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000291.2-708s1c1
	Sequence:CCGGCGGAGCTAAAGTTGCAGACAACTCGAGTTGTCTGCAACTTTAGCTCCGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000342767
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-254s21c1
	Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_000291 VALIDATED	PGK1 MISSION shRNA Lentiviral Transduction Particles phosphoglycerate kinase 1	Human

15 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000342769
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-959s21c1
	Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196810
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-338s1c1
	Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195247
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-935s1c1
	Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196454
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-313s1c1
	Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000197075
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-1068s1c1
	Sequence:CCGGGATTGTGTGGAATGGTCCTGTCTCGAGACAGGACCATTCCACACAATCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342701
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-1038s21c1
	Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342698
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-416s21c1
	Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342699
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-441s21c1
	Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195079
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000291.2-1212s1c1
	Sequence:CCGGCAAATGGAACACGGAGGATAACTCGAGTTATCCTCCGTGTTCCATTTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006178
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000291.2-1917s1c1
	Sequence:CCGGGCCTACTTTATGGCAGACATTCTCGAGAATGTCTGCCATAAAGTAGGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006182
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-151s1c1
	Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006179
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000291.2-201s1c1
	Sequence:CCGGCCCAAGCATCAAATTCTGCTTCTCGAGAAGCAGAATTTGATGCTTGGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006180
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000291.2-856s1c1
	Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000006181
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000291.2-708s1c1
	Sequence:CCGGCGGAGCTAAAGTTGCAGACAACTCGAGTTGTCTGCAACTTTAGCTCCGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000342767
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_000291.3-254s21c1
	Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_008828 VALIDATED	PGK1 MISSION shRNA Bacterial Glycerol Stock phosphoglycerate kinase 1	Mouse

15 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000301315
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-808s21c1
	Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000304261
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-1118s21c1
	Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000301386
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-251s21c1
	Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055279
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008828.1-425s1c1
	Sequence:CCGGGCTTCTGGGAACAAGGTTAAACTCGAGTTTAACCTTGTTCCCAGAAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025501
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-1013s1c1
	Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000310859
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-589s21c1
	Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000301387
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-1268s21c1
	Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025499
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-1175s1c1
	Sequence:CCGGACAGAGGATAAAGTCAGCCATCTCGAGATGGCTGACTTTATCCTCTGTTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025502
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-686s1c1
	Sequence:CCGGCAGCTGATCAATAATATGCTACTCGAGTAGCATATTATTGATCAGCTGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025503
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.1-160s1c1
	Sequence:CCGGCATCAAATTCTGCTTGGACAACTCGAGTTGTCCAAGCAGAATTTGATGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025500
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-484s1c1
	Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055278
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-1163s1c1
	Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055280
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-146s1c1
	Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055281
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-703s1c1
	Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055282
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-761s1c1
	Sequence:CCGGGTCCTCAACAACATGGAGATTCTCGAGAATCTCCATGTTGTTGAGGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_008828 VALIDATED	PGK1 MISSION shRNA shRNA Plasmid DNA phosphoglycerate kinase 1	Mouse

15 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000301315
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-808s21c1
	Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000304261
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-1118s21c1
	Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000301386
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-251s21c1
	Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055279
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008828.1-425s1c1
	Sequence:CCGGGCTTCTGGGAACAAGGTTAAACTCGAGTTTAACCTTGTTCCCAGAAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025501
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-1013s1c1
	Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000310859
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-589s21c1
	Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000301387
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-1268s21c1
	Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025499
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-1175s1c1
	Sequence:CCGGACAGAGGATAAAGTCAGCCATCTCGAGATGGCTGACTTTATCCTCTGTTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025502
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-686s1c1
	Sequence:CCGGCAGCTGATCAATAATATGCTACTCGAGTAGCATATTATTGATCAGCTGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025503
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.1-160s1c1
	Sequence:CCGGCATCAAATTCTGCTTGGACAACTCGAGTTGTCCAAGCAGAATTTGATGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000025500
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-484s1c1
	Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055278
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-1163s1c1
	Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055280
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-146s1c1
	Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055281
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-703s1c1
	Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000055282
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-761s1c1
	Sequence:CCGGGTCCTCAACAACATGGAGATTCTCGAGAATCTCCATGTTGTTGAGGACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_008828 VALIDATED	PGK1 MISSION shRNA Lentiviral Transduction Particles phosphoglycerate kinase 1	Mouse

15 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000301315
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-808s21c1
	Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000304261
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-1118s21c1
	Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000301386
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-251s21c1
	Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055279
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008828.1-425s1c1
	Sequence:CCGGGCTTCTGGGAACAAGGTTAAACTCGAGTTTAACCTTGTTCCCAGAAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025501
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-1013s1c1
	Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000310859
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-589s21c1
	Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000301387
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.2-1268s21c1
	Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025499
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-1175s1c1
	Sequence:CCGGACAGAGGATAAAGTCAGCCATCTCGAGATGGCTGACTTTATCCTCTGTTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025502
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-686s1c1
	Sequence:CCGGCAGCTGATCAATAATATGCTACTCGAGTAGCATATTATTGATCAGCTGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025503
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008828.1-160s1c1
	Sequence:CCGGCATCAAATTCTGCTTGGACAACTCGAGTTGTCCAAGCAGAATTTGATGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000025500
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-484s1c1
	Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055278
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-1163s1c1
	Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055280
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-146s1c1
	Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055281
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-703s1c1
	Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055282
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_008828.1-761s1c1
	Sequence:CCGGGTCCTCAACAACATGGAGATTCTCGAGAATCTCCATGTTGTTGAGGACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart