EMAIL THIS PAGE TO A FRIEND

PGK1

phosphoglycerate kinase 1

91 Gene Product Result for
Synonyms: MIG10 PGKA
UniProtKB ID: P00558, A8K4W6, Q5J7W1, Q6IBT6, Q8NI87
Gene ID:
Human(5230) Summary: The protein encoded by this gene is a glycolytic enzyme that catalyzes the conversion of 1,3-diphosphoglycerate to 3-phosphoglycerate. The encoded protein may also act as a cofactor for polymerase alpha. This gene lies on the X-chromosome, while a related pseudogene also has been found on the X-chromosome and another on chromosome 19. [provided by RefSeq, Oct 2008]
Mouse(18655) phosphoglycerate kinase 1
Rat(24644) phosphoglycerate kinase 1
Thale Cress(820461) phosphoglycerate kinase 1
dog(480964) phosphoglycerate kinase 1
domestic cat(101087208) phosphoglycerate kinase 1
chicken(395833) phosphoglycerate kinase 1
Zebrafish(406696) phosphoglycerate kinase 1
cow(507476) phosphoglycerate kinase 1
sheep(100216440) phosphoglycerate kinase 1
naked mole-rat(101714377) phosphoglycerate kinase 1
domestic guinea pig(100722820) phosphoglycerate kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000291 siRNAs that have been validated in the lab human pricing
NM_053291 Rosetta Predictions rat pricing
NM_008828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000291 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000014 validated 2190
1 SASI_WI_00000013 validated 1604
2 SASI_Hs01_00176820 predicted 819
3 SASI_Hs01_00176824 predicted 712
4 SASI_Hs02_00302253 predicted 286
5 SASI_Hs02_00302254 predicted 988
6 SASI_Hs02_00302255 predicted 1125
7 SASI_Hs02_00302256 predicted 1228
8 SASI_Hs02_00302257 predicted 1159
9 SASI_Hs02_00302258 predicted 1122
10 SASI_Hs02_00302259 predicted 301
11 SASI_Hs02_00302260 predicted 978
12 SASI_Hs01_00176821 predicted 725
13 SASI_Hs01_00176822 predicted 706
14 SASI_Hs01_00176823 predicted 305
15 SASI_Hs01_00176825 predicted 601
16 SASI_Hs01_00176826 predicted 206
17 SASI_Hs01_00176827 predicted 491
18 SASI_Hs01_00176828 predicted 310
19 SASI_Hs01_00176829 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265653 predicted 953
2 SASI_Rn02_00265654 predicted 531
3 SASI_Rn02_00265655 predicted 523
4 SASI_Rn02_00265656 predicted 648
5 SASI_Rn01_00033791 predicted 276
6 SASI_Rn01_00033793 predicted 229
7 SASI_Rn02_00265657 predicted 1021
8 SASI_Rn01_00033794 predicted 419
9 SASI_Rn02_00265658 predicted 576
10 SASI_Rn01_00033795 predicted 221
11 SASI_Rn01_00033792 predicted 428
12 SASI_Rn01_00033796 predicted 381
13 SASI_Rn01_00033797 predicted 970
14 SASI_Rn01_00033798 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039218 predicted 887
2 SASI_Mm01_00039219 predicted 652
3 SASI_Mm01_00039220 predicted 772
4 SASI_Mm01_00039221 predicted 257
5 SASI_Mm01_00039223 predicted 265
6 SASI_Mm01_00039224 predicted 1116
7 SASI_Mm01_00039225 predicted 745
8 SASI_Mm01_00039226 predicted 704
9 SASI_Mm01_00039227 predicted 587
10 SASI_Mm02_00314764 predicted 346
11 SASI_Mm01_00039222 predicted 1078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000291
VALIDATED
PGK1 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate kinase 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-959s21c1
Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-338s1c1
Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-935s1c1
Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-313s1c1
Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-1068s1c1
Sequence:CCGGGATTGTGTGGAATGGTCCTGTCTCGAGACAGGACCATTCCACACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-1038s21c1
Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-416s21c1
Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-441s21c1
Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000291.2-1212s1c1
Sequence:CCGGCAAATGGAACACGGAGGATAACTCGAGTTATCCTCCGTGTTCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000291.2-1917s1c1
Sequence:CCGGGCCTACTTTATGGCAGACATTCTCGAGAATGTCTGCCATAAAGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-151s1c1
Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000291.2-201s1c1
Sequence:CCGGCCCAAGCATCAAATTCTGCTTCTCGAGAAGCAGAATTTGATGCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-856s1c1
Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000291.2-708s1c1
Sequence:CCGGCGGAGCTAAAGTTGCAGACAACTCGAGTTGTCTGCAACTTTAGCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-254s21c1
Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000291
VALIDATED
PGK1 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate kinase 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-959s21c1
Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-338s1c1
Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-935s1c1
Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-313s1c1
Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000197075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-1068s1c1
Sequence:CCGGGATTGTGTGGAATGGTCCTGTCTCGAGACAGGACCATTCCACACAATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000342701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-1038s21c1
Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000342698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-416s21c1
Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000342699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-441s21c1
Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000291.2-1212s1c1
Sequence:CCGGCAAATGGAACACGGAGGATAACTCGAGTTATCCTCCGTGTTCCATTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000291.2-1917s1c1
Sequence:CCGGGCCTACTTTATGGCAGACATTCTCGAGAATGTCTGCCATAAAGTAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-151s1c1
Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000291.2-201s1c1
Sequence:CCGGCCCAAGCATCAAATTCTGCTTCTCGAGAAGCAGAATTTGATGCTTGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-856s1c1
Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000291.2-708s1c1
Sequence:CCGGCGGAGCTAAAGTTGCAGACAACTCGAGTTGTCTGCAACTTTAGCTCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000342767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-254s21c1
Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000291
VALIDATED
PGK1 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate kinase 1
Human
15 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000342769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-959s21c1
Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-338s1c1
Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-935s1c1
Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-313s1c1
Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-1068s1c1
Sequence:CCGGGATTGTGTGGAATGGTCCTGTCTCGAGACAGGACCATTCCACACAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-1038s21c1
Sequence:CCGGCTGACAAGTTTGATGAGAATGCTCGAGCATTCTCATCAAACTTGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-416s21c1
Sequence:CCGGGCTGTAGAACTCAAATCTCTGCTCGAGCAGAGATTTGAGTTCTACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-441s21c1
Sequence:CCGGGCAAGGATGTTCTGTTCTTGACTCGAGTCAAGAACAGAACATCCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000291.2-1212s1c1
Sequence:CCGGCAAATGGAACACGGAGGATAACTCGAGTTATCCTCCGTGTTCCATTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000291.2-1917s1c1
Sequence:CCGGGCCTACTTTATGGCAGACATTCTCGAGAATGTCTGCCATAAAGTAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-151s1c1
Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000291.2-201s1c1
Sequence:CCGGCCCAAGCATCAAATTCTGCTTCTCGAGAAGCAGAATTTGATGCTTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000291.2-856s1c1
Sequence:CCGGGCCAAGATTGTCAAAGACCTACTCGAGTAGGTCTTTGACAATCTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000291.2-708s1c1
Sequence:CCGGCGGAGCTAAAGTTGCAGACAACTCGAGTTGTCTGCAACTTTAGCTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000291.3-254s21c1
Sequence:CCGGCCTATGAAGAACAACCAGATACTCGAGTATCTGGTTGTTCTTCATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008828
VALIDATED
PGK1 MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate kinase 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-808s21c1
Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-1118s21c1
Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-251s21c1
Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008828.1-425s1c1
Sequence:CCGGGCTTCTGGGAACAAGGTTAAACTCGAGTTTAACCTTGTTCCCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-1013s1c1
Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-589s21c1
Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-1268s21c1
Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-1175s1c1
Sequence:CCGGACAGAGGATAAAGTCAGCCATCTCGAGATGGCTGACTTTATCCTCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-686s1c1
Sequence:CCGGCAGCTGATCAATAATATGCTACTCGAGTAGCATATTATTGATCAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.1-160s1c1
Sequence:CCGGCATCAAATTCTGCTTGGACAACTCGAGTTGTCCAAGCAGAATTTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-484s1c1
Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-1163s1c1
Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-146s1c1
Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-703s1c1
Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-761s1c1
Sequence:CCGGGTCCTCAACAACATGGAGATTCTCGAGAATCTCCATGTTGTTGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008828
VALIDATED
PGK1 MISSION shRNA shRNA Plasmid DNA
phosphoglycerate kinase 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-808s21c1
Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000304261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-1118s21c1
Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000301386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-251s21c1
Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008828.1-425s1c1
Sequence:CCGGGCTTCTGGGAACAAGGTTAAACTCGAGTTTAACCTTGTTCCCAGAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-1013s1c1
Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000310859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-589s21c1
Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000301387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-1268s21c1
Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-1175s1c1
Sequence:CCGGACAGAGGATAAAGTCAGCCATCTCGAGATGGCTGACTTTATCCTCTGTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-686s1c1
Sequence:CCGGCAGCTGATCAATAATATGCTACTCGAGTAGCATATTATTGATCAGCTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.1-160s1c1
Sequence:CCGGCATCAAATTCTGCTTGGACAACTCGAGTTGTCCAAGCAGAATTTGATGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-484s1c1
Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-1163s1c1
Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-146s1c1
Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-703s1c1
Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-761s1c1
Sequence:CCGGGTCCTCAACAACATGGAGATTCTCGAGAATCTCCATGTTGTTGAGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008828
VALIDATED
PGK1 MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate kinase 1
Mouse
15 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000301315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-808s21c1
Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-1118s21c1
Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-251s21c1
Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008828.1-425s1c1
Sequence:CCGGGCTTCTGGGAACAAGGTTAAACTCGAGTTTAACCTTGTTCCCAGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-1013s1c1
Sequence:CCGGGCTAAGCAGATTGTTTGGAATCTCGAGATTCCAAACAATCTGCTTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-589s21c1
Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.2-1268s21c1
Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-1175s1c1
Sequence:CCGGACAGAGGATAAAGTCAGCCATCTCGAGATGGCTGACTTTATCCTCTGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-686s1c1
Sequence:CCGGCAGCTGATCAATAATATGCTACTCGAGTAGCATATTATTGATCAGCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008828.1-160s1c1
Sequence:CCGGCATCAAATTCTGCTTGGACAACTCGAGTTGTCCAAGCAGAATTTGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-484s1c1
Sequence:CCGGGTCCAAACTAGGAGATGTCTACTCGAGTAGACATCTCCTAGTTTGGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-1163s1c1
Sequence:CCGGGCCAAATGGAACACAGAGGATCTCGAGATCCTCTGTGTTCCATTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-146s1c1
Sequence:CCGGGCTGCTGTTCCAAGCATCAAACTCGAGTTTGATGCTTGGAACAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-703s1c1
Sequence:CCGGGCTAGACAAAGTCAATGAGATCTCGAGATCTCATTGACTTTGTCTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008828.1-761s1c1
Sequence:CCGGGTCCTCAACAACATGGAGATTCTCGAGAATCTCCATGTTGTTGAGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)