EMAIL THIS PAGE TO A FRIEND

PGLS

6-phosphogluconolactonase

47 Gene Product Result for
Synonyms: 6PGL
UniProtKB ID: O95336
Gene ID:
Mouse(66171) 6-phosphogluconolactonase
Rat(290636) 6-phosphogluconolactonase
Zebrafish(445494) 6-phosphogluconolactonase
domestic cat(101083830) 6-phosphogluconolactonase
dog(610090) 6-phosphogluconolactonase
naked mole-rat(101712279) 6-phosphogluconolactonase
domestic guinea pig(100734971) 6-phosphogluconolactonase
cow(616120) 6-phosphogluconolactonase
sheep(101111093) 6-phosphogluconolactonase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012088 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012088 Rosetta Predictions human pricing
NM_001106066 Rosetta Predictions rat pricing
NM_025396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073481 predicted 797
2 SASI_Hs02_00343577 predicted 602
3 SASI_Hs01_00073482 predicted 741
4 SASI_Hs01_00073483 predicted 536
5 SASI_Hs02_00343578 predicted 641
6 SASI_Hs01_00073486 predicted 667
7 SASI_Hs01_00073488 predicted 364
8 SASI_Hs01_00073489 predicted 621
9 SASI_Hs01_00073490 predicted 627
10 SASI_Hs02_00343579 predicted 612
11 SASI_Hs01_00073484 predicted 333
12 SASI_Hs01_00073485 predicted 330
13 SASI_Hs01_00073487 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215292 predicted 2066
2 SASI_Rn02_00215293 predicted 2082
3 SASI_Rn02_00215294 predicted 2093
4 SASI_Rn02_00215295 predicted 1598
5 SASI_Rn02_00215296 predicted 2134
6 SASI_Rn02_00215297 predicted 1785
7 SASI_Rn02_00215298 predicted 2015
8 SASI_Rn02_00215299 predicted 1921
9 SASI_Rn02_00215300 predicted 1603
10 SASI_Rn02_00215301 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328146 predicted 618
2 SASI_Mm01_00173392 predicted 318
3 SASI_Mm01_00173393 predicted 590
4 SASI_Mm01_00173395 predicted 485
5 SASI_Mm02_00328147 predicted 302
6 SASI_Mm01_00173396 predicted 344
7 SASI_Mm02_00328148 predicted 488
8 SASI_Mm01_00173397 predicted 606
9 SASI_Mm01_00173398 predicted 587
10 SASI_Mm02_00328149 predicted 302
11 SASI_Mm01_00173394 predicted 529
12 SASI_Mm01_00173399 predicted 538
13 SASI_Mm01_00173400 predicted 427
14 SASI_Mm01_00173401 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025396
VALIDATED
PGLS MISSION shRNA Bacterial Glycerol Stock
6-phosphogluconolactonase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-489s21c1
Sequence:CCGGCGGCCATACCTGTTCGCTCTTCTCGAGAAGAGCGAACAGGTATGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-401s1c1
Sequence:CCGGGCAGAGGACTATGCCAGGAAACTCGAGTTTCCTGGCATAGTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-594s21c1
Sequence:CCGGCCTAACGCTTCCTGTGCTGAACTCGAGTTCAGCACAGGAAGCGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-615s21c1
Sequence:CCGGCGCAGCCCAAAGTATCATCTTCTCGAGAAGATGATACTTTGGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-400s21c1
Sequence:CCGGGCAGAGGACTATGCCAGGAAACTCGAGTTTCCTGGCATAGTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-365s1c1
Sequence:CCGGCTTACCATCAATCCTGCCCTACTCGAGTAGGGCAGGATTGATGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-595s1c1
Sequence:CCGGCCTAACGCTTCCTGTGCTGAACTCGAGTTCAGCACAGGAAGCGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-616s1c1
Sequence:CCGGCGCAGCCCAAAGTATCATCTTCTCGAGAAGATGATACTTTGGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-490s1c1
Sequence:CCGGCGGCCATACCTGTTCGCTCTTCTCGAGAAGAGCGAACAGGTATGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025396
VALIDATED
PGLS MISSION shRNA shRNA Plasmid DNA
6-phosphogluconolactonase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-489s21c1
Sequence:CCGGCGGCCATACCTGTTCGCTCTTCTCGAGAAGAGCGAACAGGTATGGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-401s1c1
Sequence:CCGGGCAGAGGACTATGCCAGGAAACTCGAGTTTCCTGGCATAGTCCTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-594s21c1
Sequence:CCGGCCTAACGCTTCCTGTGCTGAACTCGAGTTCAGCACAGGAAGCGTTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000308408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-615s21c1
Sequence:CCGGCGCAGCCCAAAGTATCATCTTCTCGAGAAGATGATACTTTGGGCTGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000308407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-400s21c1
Sequence:CCGGGCAGAGGACTATGCCAGGAAACTCGAGTTTCCTGGCATAGTCCTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-365s1c1
Sequence:CCGGCTTACCATCAATCCTGCCCTACTCGAGTAGGGCAGGATTGATGGTAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-595s1c1
Sequence:CCGGCCTAACGCTTCCTGTGCTGAACTCGAGTTCAGCACAGGAAGCGTTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-616s1c1
Sequence:CCGGCGCAGCCCAAAGTATCATCTTCTCGAGAAGATGATACTTTGGGCTGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000101567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-490s1c1
Sequence:CCGGCGGCCATACCTGTTCGCTCTTCTCGAGAAGAGCGAACAGGTATGGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025396
VALIDATED
PGLS MISSION shRNA Lentiviral Transduction Particles
6-phosphogluconolactonase
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000308348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-489s21c1
Sequence:CCGGCGGCCATACCTGTTCGCTCTTCTCGAGAAGAGCGAACAGGTATGGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-401s1c1
Sequence:CCGGGCAGAGGACTATGCCAGGAAACTCGAGTTTCCTGGCATAGTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-594s21c1
Sequence:CCGGCCTAACGCTTCCTGTGCTGAACTCGAGTTCAGCACAGGAAGCGTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-615s21c1
Sequence:CCGGCGCAGCCCAAAGTATCATCTTCTCGAGAAGATGATACTTTGGGCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025396.3-400s21c1
Sequence:CCGGGCAGAGGACTATGCCAGGAAACTCGAGTTTCCTGGCATAGTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-365s1c1
Sequence:CCGGCTTACCATCAATCCTGCCCTACTCGAGTAGGGCAGGATTGATGGTAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-595s1c1
Sequence:CCGGCCTAACGCTTCCTGTGCTGAACTCGAGTTCAGCACAGGAAGCGTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-616s1c1
Sequence:CCGGCGCAGCCCAAAGTATCATCTTCTCGAGAAGATGATACTTTGGGCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025396.1-490s1c1
Sequence:CCGGCGGCCATACCTGTTCGCTCTTCTCGAGAAGAGCGAACAGGTATGGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012088
VALIDATED
PGLS MISSION shRNA Bacterial Glycerol Stock
6-phosphogluconolactonase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-336s21c1
Sequence:CCGGCGGACGCATCTTCTCTCCAGACTCGAGTCTGGAGAGAAGATGCGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-802s21c1
Sequence:CCGGCCTTCGAGAAGCATTCCACTTCTCGAGAAGTGGAATGCTTCTCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-676s21c1
Sequence:CCGGCAGCTGTTCTGAAGCGCATTTCTCGAGAAATGCGCTTCAGAACAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012088.2-746s1c1
Sequence:CCGGCACCGGGAAACTGTGCTGGTTCTCGAGAACCAGCACAGTTTCCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-633s21c1
Sequence:CCGGGCAGCACGAACTGTCATCTTTCTCGAGAAAGATGACAGTTCGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012088.2-633s1c1
Sequence:CCGGGCAGCACGAACTGTCATCTTTCTCGAGAAAGATGACAGTTCGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012088.2-802s1c1
Sequence:CCGGCCTTCGAGAAGCATTCCACTTCTCGAGAAGTGGAATGCTTCTCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012088.2-336s1c1
Sequence:CCGGCGGACGCATCTTCTCTCCAGACTCGAGTCTGGAGAGAAGATGCGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012088
VALIDATED
PGLS MISSION shRNA shRNA Plasmid DNA
6-phosphogluconolactonase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-336s21c1
Sequence:CCGGCGGACGCATCTTCTCTCCAGACTCGAGTCTGGAGAGAAGATGCGTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000306823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-802s21c1
Sequence:CCGGCCTTCGAGAAGCATTCCACTTCTCGAGAAGTGGAATGCTTCTCGAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000289362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-676s21c1
Sequence:CCGGCAGCTGTTCTGAAGCGCATTTCTCGAGAAATGCGCTTCAGAACAGCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012088.2-746s1c1
Sequence:CCGGCACCGGGAAACTGTGCTGGTTCTCGAGAACCAGCACAGTTTCCCGGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000289461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-633s21c1
Sequence:CCGGGCAGCACGAACTGTCATCTTTCTCGAGAAAGATGACAGTTCGTGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012088.2-633s1c1
Sequence:CCGGGCAGCACGAACTGTCATCTTTCTCGAGAAAGATGACAGTTCGTGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012088.2-802s1c1
Sequence:CCGGCCTTCGAGAAGCATTCCACTTCTCGAGAAGTGGAATGCTTCTCGAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012088.2-336s1c1
Sequence:CCGGCGGACGCATCTTCTCTCCAGACTCGAGTCTGGAGAGAAGATGCGTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012088
VALIDATED
PGLS MISSION shRNA Lentiviral Transduction Particles
6-phosphogluconolactonase
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000306824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-336s21c1
Sequence:CCGGCGGACGCATCTTCTCTCCAGACTCGAGTCTGGAGAGAAGATGCGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-802s21c1
Sequence:CCGGCCTTCGAGAAGCATTCCACTTCTCGAGAAGTGGAATGCTTCTCGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-676s21c1
Sequence:CCGGCAGCTGTTCTGAAGCGCATTTCTCGAGAAATGCGCTTCAGAACAGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012088.2-746s1c1
Sequence:CCGGCACCGGGAAACTGTGCTGGTTCTCGAGAACCAGCACAGTTTCCCGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012088.2-633s21c1
Sequence:CCGGGCAGCACGAACTGTCATCTTTCTCGAGAAAGATGACAGTTCGTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012088.2-633s1c1
Sequence:CCGGGCAGCACGAACTGTCATCTTTCTCGAGAAAGATGACAGTTCGTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012088.2-802s1c1
Sequence:CCGGCCTTCGAGAAGCATTCCACTTCTCGAGAAGTGGAATGCTTCTCGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012088.2-336s1c1
Sequence:CCGGCGGACGCATCTTCTCTCCAGACTCGAGTCTGGAGAGAAGATGCGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)